Answered: Blank is the enzyme that is used in…

Science

Biology

Blank is the enzyme that is used in transcription and blank is the enzyme used in translation

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 3SQ: mRNA is produced by ___________. a. replication b. duplication c. transcription d. translation

See similar textbooks

Related questions

Q: The genetic code is said to be degenerate. This means that... A the code is universal used by…

A: The genetic code is a triplet code called a codon.

Q: What is the muscarininc acetylcholine receptor? Where is it expressed?

A: Membrane proteins are proteins that are embedded in the cell membrane. Unsurprisingly, they are…

Q: Which of the following statements are correct? P. Plasma membrane is highly impermeable to all…

A: The plasma membrane is a lipid bilayer membrane which surrounds the cells. The membrane is…

Q: 11. Which of the following is located in the vertebral canal at the level of site X in the x-ray…

A: In this question we have to Describe about vertebral column and their spinal cord.

Q: Explain how mismatch repair fixes incorrectly matched base pairs.

A: During DNA synthesis, most DNA polymerases use a process is called proofreading to double-check…

Q: Question 8 In the following plasmid, if the region between the 2 sites for HgiEll were deleted, the…

A: Origin of replication is the DNA sequence in the plasmid from where the replication of the plasmid…

Q: Differentiate the types of venation.

A: Venation is the arrangement of veins in a leaf or in an insect's wing. This type of arrangement is…

Q: Which is established by the electron transport chain and can be used to drive cellular work…

A: In this question we have to describe how ATP formation take place. See full answer in step 2-

Q: Which of the field biology tools would be preferred for the species-area curves in a forest…

A: Species area curves in forest ecosystems.

Q: There is energy requirement for every amino acid added in a growing polypeptide chain. A True B)…

A: Translation is a process of synthesizing of amino acid chain. In the first step of translation,…

Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…

Q: Refer to the figure below to answer the question that follows. 45-85+ male female 215-11 0-14 Rapid…

A: Fertility rate at a given age is the number of children born alive to a women of that age during the…

Q: What fundamental structure organization allows both chloroplasts and mitochondria to establish a…

A: Chloroplast is responsible for photosynthesis. Whereas mitochondria is responsible for respiration.…

Q: Make a complete blood flow tracing using the illustration: a) from the caudal fin tail and back to…

Q: E B a. Draw the structure of the acentromeric chromosome using a line and letters to designate loci…

A: Inversion is one type of chromosome aberration where the chromosome segment is excised and…

Q: Which of the following statements are correct? P. Plasma membrane is highly impermeable to all…

A: Membrane transport refers to the collection of mechanisms that regulate the passage of solutes such…

Q: What determines the maximum rate of Action Potential firing?

A: An action potential is a short-lived event where the electrical membrane potential of a cell rapidly…

Q: Describe how mRNA is created in transcription step by step.

A: Gene expression is a cycle by which the qualities are gone on to frame RNA and proteins. This is…

Q: Which phytochemical antioxidant makes fruit red? Beta-carotene Lignans Lycopene Monoterpenes

A: Carotenoids are a collection of phytochemicals that are liable for the yellow, orange and red shades…

Q: 1. Describe the pathway of energy in light-dependent reactions. 2. Think of your own metaphor or…

A: The light-dependent reactions convert light energy into the energy storage molecule ATP and the…

Q: Which of the following statements is NOT TRUE about the organization and function of chloroplasts…

A: The mitochondria and chloroplast both have some similarities in there structures and functions. Both…

Q: Question 25 As in RNA and DNA synthesis, the synthesis of proteins follows the following steps,…

A: Protein synthesis refers to the process through which cells produce proteins. Transcription and…

Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…

Q: Genetic resources Climate regulation Seed dispersal Aquaculture Recreation and ecotourism Air and…

A: Introduction All ecosystems provide numerous benefits to humans. These varied benefits provided by…

Q: For linkage analysis, a test cross is used rather than a hybrid cross. Why is this essential? Why…

A: Test cross allows to measure the frequency of gametes indirectly which is made by an individual.…

Q: Question 44 Plasmids to become effective vectors and cloning really successful, they must be double…

A: Plasmids are Independent extrachromosomal DNA. These replicate independently of DNA hence it is used…

Q: Task Nº1. The disease is described in which the activity of phosphofructokinase of adipose tissue…

A: Introduction :- Body fat is a term used to describe adipose tissue. It can be found in every part of…

Q: Question 42 The term "clone" refers to any genetically identical population. A True B) False

A: Answer : The term "clone" refers to any genetically identical population . This is TRUE because…

Q: Calculate the driving force for Na+, K+, and Ca2+ current in a neuron under physiological…

A: Driving force refers to the difference between the actual membrane potential and an ion's…

Q: Protein biosynthesis in all cells utilizes energy driving the assembly process provided by _____…

A: protein biosynthesis in all cells utilizes energy driving the assembly process provided by GTP…

Q: Genetic resources Climate regulation Seed dispersal Aquaculture Recreation and ecotourism Air and…

A: Genetic resources - provisioning service Climate regulation - regulating service Seed dispersal -…

Q: Question 28 The anticodon of a tRNA is 5'UUG. What codon(s) can be theoretically recognized by this…

A: RNA is a type of nucleic acid which is comprised of single standard poly nucleotide chain and…

Q: Are mutations equally likely to occur in all locations in the genome? Why or why not?

A: Mutation: The changes that occur in DNA sequence or helical structure due to mutagens. These are…

Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize yo…

A: Aerobic cellular respiration includes glycolysis, Krebs cycle and ETC.

Q: Which of the following is NOT an example of active transport in animals? * Amino acids moving along…

A: Passive transport does not require energy. Active transport requires energy.

Q: Explain how mismatch repair fixes incorrectly matched base pairs.

A: During DNA synthesis, most DNA polymerases use a process is called proofreading to double-check…

Q: What is a typical value for an inhibitory post synaptic potential? Why is it inhibitory?

A: An inhibitory post synaptic potential is a kind of synaptic potential that makes a postsynaptic…

Q: With respect to wobble hypothesis all of the following are correct except: An inosine nucleotide in…

A: Introduction According to the Wobble hypothesis only the first two bases of the codon pairs with the…

Q: Anita is constipated. Which of the following will you recommend to her? * Food rich in soluble…

A: Introduction A cell cycle is a set of events that occur in a cell as it divides and grows. A cell…

Q: The inducible galactose operon of E. coli has three co-transcribed genes (galk, galE, galT) encoding…

A: Galactose operon is a prokaryotic operon involved in the utilization of galactose/galactose…

Q: Which of the following statements are correct about nodule formation by Rhizobium species? P. Nodule…

A: Rhizobium is a nitrogen fixing bacteria. It is showing symbiotic interactions with the legume…

Q: Which of the following is not a characteristic of plant hormones? They are active in small…

A: Plant hormones like Auxin, Cytokinin, etc. are produced at extremely low concentrations. At very…

Q: Evolution has the creation of systems that are present to accurately respond to environmental…

A: Introduction DNA acts as genetic material for living organisms. DNA damage can occurs due to various…

Q: 40. Administration of prednisone for long periods causes atrophy of which of the following endocrine…

A: Prednisone is a glucocorticoid medication mostly used to suppress the immune system and decrease…

Q: How does a 2x2 punnet square for a trait that is described by incomplete dominance different from a…

A: Dominant character expresses itself in homozygous or heterozygous condition. Recessive character…

Q: a specimen from an infected wound has been submitted to the clinical laboratory. Explain in detail…

A: Mostly Staphylococcus aureus causes the infected wound infection but sometimes other bacteria ?…

Q: 47. A 16-year-old girl is brought to the emergency department 30 minutes after she was hit by a car…

A: Anterior tear of vaginal vestibule and pelvic fracture due to injury.

Q: 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the…

A: 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the…

Q: What happens to synaptic transmission during an experiment if the preparation (containing 1 amotor…

A: Neurotransmitters are chemical messengers or signaling molecules released from neurons to transmit…

Q: Activation of the fatty acid (converting it to fatty acyl-SCoA) requires the expenditure of 2 ATPs.…

A: There are 3 steps of beta oxidation of saturated fatty acids. This phenomena occurrs in the cytosol,…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

Blank is the enzyme that is used in transcription and blank is the enzyme used in translation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
mRNA is produced by ___________. a. replication b. duplication c. transcription d. translation
Energy that drives transcription is provided mainly by _______ . a. ATP c. GTP b. RNA nucleotides d. RNA polymerase
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. introns
The transcription enzyme that catalyzes a strand of RNA from a DNA template is called what?
Which type of gene controls functions like an "on-off" switch for gene transcription? A. DNA methylation B. Phosphorylation C. translation D. protein degradation
Transcription of genes starts at regions of the genome called
Transcribe the gene to the mRNA sequence and label start and stop codon. Translate mRNA to protein sequence.
The product of transcription is a polypeptide. a short piece of RNA. a short piece of DNA. a sequence of amino acids.
Given the gene below, perform the process of transcription and translation. Try to align each triplet/codon into their own “column.”
If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA transcription and translation what would be the amino acid sequence of the product?