How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA sequence shown below can result in non-sense mutations (a stop codon replaces an amino acid codon) in the second generation in a bacterial strain that is defective in DNA repair? Amino Acids Gln Trp Thr Arg Coding strand: 5'-CAA TGG ACT CGA-3¹ For your information, Stop codons: TAA, TAG, TGA *Ignore Insertions, and Deletions for this question O None of these options O 16 4 0 1 O 2

How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA sequence shown below can result in non-sense mutations (a stop codon replaces an amino acid codon) in the second generation in a bacterial strain that is defective in DNA repair? Amino Acids Gln Trp Thr Arg Coding strand: 5'-CAA TGG ACT CGA-3¹ For your information, Stop codons: TAA, TAG, TGA *Ignore Insertions, and Deletions for this question O None of these options O 16 4 0 1 O 2

Name: How many different single-nucleotide substitutions* (changing one nuc
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA sequence shownbelow can result in non-sense mutations (a stop codon replaces an amino acid codon) in the second generation in abacterial strain that

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
What is the amino acid sequence of the peptide that would be synthesized after transcription and translation of the following piece of template strand DNA? 5' 3' codon translations _________________________ codon amino acid T C A T G C G C A A C A AGU Ser ACG Thr CGU Arg UGU Cys UGC Cys GCA Ala UGA stop
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
The following sequence of DNA is part of the normal, wild-type gene. 5'TAC CGG GAC TTG AGC CGA TAG 3' A deletion occurs during DNA replication, causing the guanine shown in red to be removed from the nucleotide strand. What effect is this most likely to have on the final protein? Multiple Choice The deletion of the G will cause a single amino acid substitution in the codon in which it occurs. The deletion of the G will cause a frameshift, so that the first amino acid after the mutation will change but the rest of the protein is unaffected. The deletion of the G will cause a frameshift, resulting in a premature stop codon and a truncated protein. The deletion of the G will cause a frameshift, resulting in the loss of the normal stop codon and an abnormally long protein with an altered amino acid sequence. The deletion of the G will not have an effect on the final protein.
A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence: CGA AAA GAG AAT A mutation in the above sequence involved a substitution of a single base, resulting in an incomplete protein due to a nonsense mutation. Which of the following gen sequences exemplifies the mutation described above? a. CGA UAA GAG AAT b. CGA AAA AAG AAT c. CGA AAA GAG ACT d. UGA AAA GAG AAT
A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What amino acids are encoded by this sequence?
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
Which of the following statements is true?a) Exonuclease III removes nucleotide residues from the 3’ ends of a DNA strandb) Bacteriophage lambda exonuclease removes terminal phosphatesc) Alkaline phosphatase removes nucleotides from 5‘endsd) Kinase adds homopolymer tails to the 3’ –OH ends of a linear duplex
The following fragment of DNA is from the template strand. First determine the amino acids of the protein encoded by this sequence by using the table at the end of this document. Then give the altered amino acid sequence of the proteins that will be found in each of the following mutations: 3’ – TAC AAG GCT CTA TTT GCC ACA ATC – 5’ The nucleotides are numbered 1-24 from left to right. Mutant 1: A transition at nucleotide 9 Mutant 2: A transition at nucleotide 11 Mutant 3: A T to A transversion at nucleotide 15 Mutant 4: A one-nucleotide deletion at nucleotide 7 Mutant 5: A transition at nucleotide 13 Mutant 6: An addition of GGA after nucleotide 6
Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY. 2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. 3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. please answer the 3 questions, thank you so much!
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
The compound known as nitrous acid is a reactive chemical that replaces amino groups (NH2) with keto groups (=O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil and change adenine to hypoxanthine. A DNA double helix has the following sequence: AACCTACGACC TTGGATGCTGG A. What would be the sequence of this double helix immediately after reaction with the nitrous acid (i.e. before replication)? Let the letter H represent hypoxanthine and U represent uracil. B. Following exposure the nitrous acid was removed, and the DNA was replicated for one generation. What would be the sequence of the DNA products after the DNA sequence resulting from treatment in Part A had replicated once? Your answer should contain the sequences of two double stranded DNA molecules. Note: During DNA replication, uracil hydrogen bonds with adenine, and hypoxanthine hydrogen bonds with cytosine.