I have to write a python program using a json file. Typically this exact question https://www.bartleby.com/questions-and-answers/program-tasks-write-a-program-displayclimate.py-that- performs-the-following-functionalities-a.-reads/d94a565a-7220-4c3c-b8a1-5329aa603f62 But I would only like to show 12 values for 12 months in the average rainfall list. And would also like to make it into modular functions with exception handeling

I have to write a python program using a json file. Typically this exact question https://www.bartleby.com/questions-and-answers/program-tasks-write-a-program-displayclimate.py-that- performs-the-following-functionalities-a.-reads/d94a565a-7220-4c3c-b8a1-5329aa603f62 But I would only like to show 12 values for 12 months in the average rainfall list. And would also like to make it into modular functions with exception handeling

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Develop a python program that will determine the required mass of one compound based on three parameters: (1) compound name, (2) liters of solution, and (3) molarity The input should be in a single text file (input.txt). The required mass should be in a single text file (output.txt). Only two decimal places should be included in the output.txt. You can use the three files here https://filebin.net/twyx8f7q8lqr1cno to aid in doing the program -main.py includes the logic behind how output.txt is made based on the input.txt -compound.py. includes the strructure of compound class -periodictable.csv contains the information of the elements in the chemistry table of elements Example: ***input.txt*** compound,liter,molarity NH4Cl, 0.1, 2.5 NaCl, 0.5, 0.25 Na2CO3, 0.75, 1.25 ***output.txt*** 13.37 7.31 99.36
make a example code related to orginizing files in python . Save it as 201916791. py and send screen shot with output
Write a C/C++ language program that reads the file numbers.txt and checks each number for being a prime number. Only the prime numbers from these are then written to a text file prime.txt.
Early Unix implementations used filenames which were up to 14 characters long. Normally, storing a 14 character string in C would require 15 bytes but to save storage only 14 bytes were used with the terminating NUL character not being stored for filenames which were exactly 14 characters long. Discuss how you would convert this possibly unterminated string into a proper NUL-terminated C string in a char buf[15]. You may use functions from the C standard library
Run a python program that will: a. Read a text file (input.txt) that contains two lines wherein the first line is a normal DNA sequence, while the second line is a mutated DNA sequence. b. The program must also transcribe and translate the sequences by providing outputs for their respective mRNA and protein products. *** input.txt *** ATGGTCAGAACGCGCTGAAATGGTTAGAACGCGCTGAC *** your.py *** Normal RNA Sequence: UACCAGUCUUGCGCGACUUMutated RNA Sequence: UACCAAUCUUGCGCGACUG Normal Protein Sequence: Try Gln Ser Cys Ala ThrMutated Protein Sequence: Try Gln Ser Cys Ala Thr
a. Use an interactive Python session (shell/IDLE) to print out a line of 11 stars 7 times (so there will be 7 lines of output with each line containing 11 stars). b. Write a function that does the same thing as above, having each line printed individually. c. Write a function that uses a loop to do the same thing.
make a example code related to orginizing files in python . Save it as 201916791. py and take a picute also send it to me
Write Python commands, within a print command, that output the following. (E.g. print(list(range(10))) ) Let x = [1,3,5] and let y = [2,4,6]. If we interpret these as vectors x and y then the vector sum can be written x + y = [x[0]+y[0],x[1]+y[1],x[2]+y[2]]. Find an the equivalent expression for the vector dot product x.y
Write a Python program, final_q9.py , which takes one command line argument, the name of a file.final_q9.py will be given a single positive integer n indicating a maximum desired line length.Your program should change the file in the following way:• Lines containing n characters or less, not including the new line, should not be changed.• Lines not containing a space character (' ') should not be changed.• Lines containing more than n characters with a space in the first n characters,should have the last space in the first n characters changed to a newline character ('\n').• Lines containing more than n characters without a space in the first n characters,should have the first space on the line changed to a newline character ('\n').The above rules should also be applied to new lines as they are created.Your program should not print anything to stdout.The only thing it should do is change the file.For example:COMP(2041|9044) 22T2 — 22T2 Final Exam Questions…
In Python, Given the grades.csv file, where hours = [15,7,8,7.3,19.1,17,14,9.3,4.3,8,12.4,9,6,7.5], and grades = [94,86,87,100,96,94,90,79,88,91,90,86,88,89]. The first column is hours studied and the second column is grades, read its data and place them into two numpy arrays. Find the regression line using the built-in linregress() method. Plot the data points along with the regression line and print: slope, y-intercept, r (correlation coefficient), p-value, standard error. Predict a student’s grade given 10.5 hours of study''' xhours = [ ] yhours = [ ]
Design a python program that reads a file named "scores.txt containing lines of test scores separated by commas. Read each line in the file and put each line of scores in a list. Sort the scores in each list in decreasing order and display each list. The contents of "scores.txt" are as follows: 85.6, 92.2, 57.9, 45.7 39.4, 55,6, 99.9, 46.3 98.8, 90.4, 79.3, 66.7
Write a general-purpose program that is able to add two 8 bytes length numbers. Numbers are saved in EBX: EAX and EDX: ECX Consider this sample call: Number1 QWORD = 1234567898765432h Number2 QWORD = 1234567898765432h Please write code in Masm (Microsoft assembly) No High-Level Assembly. And please don't separate the variables, keep it as it is. If you do split it please do it in the code part. If possible please use 1 loop anything more than inc, dec, mov, xchg, I don't know how to do that yet.