If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual

If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after methionine is cleaved off?
Explain the structural activity between trans-ferulic acid and the NS2B-NS3 protease in the DENV-2 strain? Please refer to the specific conserved domains affected in the NS2B-NS3 Protease by trans ferric acid and how trans ferric acid can prevent viral replication by inhibiting the activity of the NS2B-NS3 protease in DENV-2.
The haemoglobin proteins of RNA polymerase ii sub units RPB1-P24928 RPB2-P30876 RPB3-P19387 RPB4-015514 are they similar? Explain?
Each intracellular fusion of a vesicle with a membrane requires a SNARE protein on the vesicle (called the v-SNARE) and a SNARE protein on the target membrane (called the t-SNARE). Assume that a genome encodes 21 members of the vSNARE family and 7 members of the t-SNARE family. With the assumption of no specificity, how many potential v-SNARE–t-SNARE interactions could take place?
Contrast the functions of Spo11 and Cas9, twoenzymes that catalyze the formation of doublestrand breaks
Based on the following wild type sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table). Wild Type: GUC GCC GAC GAG AGG Mutant 1: GUC GCC AGA CGA GAG G Mutant 2: GUC GCC ACG AGA GG Mutant 3: GUC GCC AAC GAG AGG Mutant 4: GUA GCC GAC GAG AGG Mutant 5: GUC GCC GAC UAG AGG
Identify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general function of the protein
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?
What is the mechanism of the Contactin-BIG-1
The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′