If the molecule can inhibit toxic effects at 0.5mM against gastric carcinoma cells, does it mean that the dimer of this nucleoside analogue will exhibit an IC50 of about 0.25mM?
Q: Based on the figure and the explanation in the textbook, what are the random chances that the…
A: Denaturation is the process by which proteins lose their native conformation. Ribonuclease A has 124…
Q: Write a balanced equation for the synthesis of TMP from dUMP that is coupled to the conversion of…
A: Biomolecules are organic molecules that occur in living systems. Biomolecules include carbohydrates,…
Q: If this molecule can inhibit toxic effects at 0.5mM against gastric carcinoma cells, does it mean…
A: IC50 is the concentration at which 50% inhibitory effect is observed.
Q: 2,3-Bisphosphoglycerate lies in a central cavity within the hemoglobin tetramer, stabilizing the T…
A: BPG is present in the RBCs of human beings and other species. It is a highly charged anion. In…
Q: . Most bacterial mutants that require isoleucine for growth also require valine. Why? Which enzyme…
A: A mutation is a permanent alteration in the sequence of nitrogenous bases of a DNA molecule.
Q: Peptide Y is a polymorphic analogue of Peptide X. If peptide X with endorphin-like property was…
A: Streptococcal protease could be any of the serine protease. as streptococcus is the general source…
Q: Sodium nitrite, a common food preservative (page 906), is capable of causing mutations in an acidic…
A: Sodium nitrite, a common food preservative , is capable of causing mutations in an acidic…
Q: How many times does the enzyme Mbol cut between positions 1426-2789 inclusively of the sequence with…
A: The Mbol is a restriction enzyme. Restriction enzymes cleave the double-stranded DNA at the…
Q: Fibrinogen contains tyrosine- O - sulfate. Propose an activated form of sulfate that could react in…
A: Tyrosine O-sulfation of protein is a post-translational modification that mostly occurs in…
Q: What are the possible sources of errors or deviations between the theoretical and experimental pKa…
A: pKa value: pKa or Acid dissociation constant is also known as acidity constant or acid-ionization…
Q: Given a primer sequence 3’- CTGGGAAACATTCTGGAT - 5’, compute for the melting temperature of this…
A: Melting temperature of primer can be defined as a temperature at which one half of the DNA double…
Q: Compounds A, B, C, and D are known to be intermediates in the pathway for production of protein E.…
A: In the question, E protein production pathway involves intermediates A, B, C, and D. Mutation or…
Q: What function does a guanine nucleotide exchange factor(GEF) serve?
A: Small GTPases or small G-protein is a type of hydrolase enzyme found in the cytosol of the cell.…
Q: In oxygenated hemoglobin, pKa 5 6.6 forthe histidines at position 146 on the -chain. In…
A: Bohr effect - With increasing H+ concentration (lower pH) or when hemoglobin is exposed to increased…
Q: In 1925, Briggs and Haidane reported on the modifications of the michaelis-menten equation. Briefly…
A: Michaelis Menten equation relates reaction velocity with the concentration of substrate. Here, the…
Q: In the serine protease triad, the proximity of an aspartatecarboxylate group to the imidazole group…
A: A serine protease triad is referred to as the protease that catalyzes the hydrolysis of the peptide…
Q: After being stabilized with supplemental oxygen, a blood transfusion, and medication to help with…
A: Hydroxyurea: It is a class of antimetabolites. This class of drug is used to treat cancer. It is a…
Q: Describe the steric interactions that determine the conformations that pyrimidine nucleosides…
A: Pyrimidine is an organic compound which has heterocyclic ring. It fuses with the nitrogenous bases…
Q: describe a detailed experimental procedure for the chemical synthesis of proteins with the…
A: Proteins are vital biomolecules that plays key role in biochemical pathways. It is synthesized in…
Q: For the following concentrations, determine the equivalent of a. 75ug/mg lyophilized protein in ppm…
A: Proteins are a type of macromolecule that have a variety of roles in biological processes. It is…
Q: Given a tripeptide Cys-His-Lys, Cys: Pk1 = 1.71; Pk2 = 10.78; PkR = 8.33 His: Pk1 = 1.82; Pk2 =…
A: The pKa values of amino acid side chains that constitute a protein play an important role in…
Q: The SARS-CoV-2 spike protein is heavily glycosylated. What are some of the monosaccharides found in…
A: The spike (S) protein of SARS-CoV-2 mediates the virus binding to the human cells via its…
Q: In biochemical and structural terms, how does the cellular form of the prion protein differ from the…
A: There are different macromolecules present in the living organism. Of which proteins are one of the…
Q: What is the TOTAL NET CHARGE of a free arginine amino acid at pH = 12.5?
A: Arginine is a basic amino acid in which three ionizable groups present. Arginine amino acid consists…
Q: If the molecule can inhibit toxic effects at 0.5mM against gastric carcinoma cells, does it mean…
A: IC 50 is half maximal inhibitory concentration which measures potency of substance to inhibiting…
Q: Why is a strong reducing agent, such as NaBH4, not suitable for use in the conjugation of an…
A: Oligosaccharides are molecules that consist of many smaller monosaccharide units. Oligosaccharides…
Q: 25) Although the UV280 extinction coefficient of BSA is well known, why was the BCA assay employed…
A: Protein assays normally used to standards to quantify quality of other protein, by comparing unknown…
Q: What is the dominant biochemical activity or molecular interaction that Sickle Cell Anemia…
A: Hemoglobin is an oligomeric conjugated protein with four peptide chains joined by a…
Q: . What physiological effect would you predict from a mutation that replaced with serine the cysteine…
A: Immunoglobulin (Ig), is considered as the protein, which is produced by the immune cells such as…
Q: Carbohydrates can play important roles by modulating interactions between proteins. For example,…
A: Thrombin (coagulation factor II) is a serine protease that plays a vital role in hemostasis and…
Q: Why is there no net gain of methionine if homocysteine isconverted to methionine with…
A: Methionine is an amino acid which is found in meat, fish and dairy products and it plays an…
Q: Calculate the net charge of the the tripeptide Asp-Asp-Asp at pH 1.00?
A: At low pH, the molecule is fully protonated, as the pH increases more than pKa of an ionizable…
Q: Antithrombin III forms an irreversible complex with thrombin but not with prothrombin. What is the…
A: The blood cell is also called a hematopoietic cell. It is produced by the process named…
Q: An enzyme (molecular weight= 24 kDa, pI= 5.5) is contaminated with two other proteins, one with a…
A: Mixture of an enzyme and two contaminated protein has to be separate to purify the enzyme. For the…
Q: Bisphosphoglycerate lies in a central cavity within the hemoglobin tetramer, stabilizing the T…
A: Hemoglobin (Hb) is the protein complex, which is a tetramer in a structure that binds to the oxygen…
Q: Given that the molar extinction coefficient of lysozyme is 37200 Abs M-1cm-1, calculate the…
A: According to the Lambert Beer's law: Absorbance = (extinction coefficient) x (concentration) x (path…
Q: Since mammalian DNA contains roughly 25% thymine residues, why do mammalian cells need a thymine-DNA…
A: Introduction: DNA is the type of nucleic acid that is present in the nucleus of the cell. It is the…
Q: A molecule of composition5′-AAAAAAAAAAA-3′3′-TTTTTTTTTTTTT-5′is replicated in a solution containing…
A: Atoms with unstable nuclei regain what is supposed to describe as they are about to define stability…
Q: In studies using repeating copolymers, AC . . . incorporates threonine and histidine, and CAACAA . .…
A: A protein's amino acid sequence is determined by the sequence of nucleotides in DNA and RNA. It is…
Q: Most bacterial mutants that require isoleucine for growth also require valine.Why? Which enzyme or…
A: Mostly the bacteria that require the isoleucine amino acid for growth also requires valine. This is…
Q: A mutant is found that has the following protein sequence: Met Gly Thr Leu Arg Gly. What is the…
A: Mutation is defined as the alteration in gene that result in alteration in the function of the…
Q: Explain the 7-methylguanosine (m7G) ? Define its importance ?
A: The glycosylamines that can be thought of as nucleotides without a phosphate group are known as the…
Q: This molecule forms a dimer via pi interactions, resulting to effective molecular stacking. If the…
A: IC50 is the half maximal inhibitory concentration of a drug that is important to know the amount of…
Q: Using the following data, determine the correct sequence of the octapeptide. Edmund's Reaction =…
A: Chains of Amino acids are held together through a peptide bond to form a structure known as…
If the molecule can inhibit toxic effects at 0.5mM against gastric carcinoma cells, does it mean that the dimer of this nucleoside analogue will exhibit an IC50 of about 0.25mM?
Step by step
Solved in 2 steps with 1 images
- This molecule forms a dimer via pi interactions, resulting to effective molecular stacking. If the molecule can inhibit toxic effects at 0.5mM against gastric carcinoma cells, does it mean that the dimer of this nucleoside analogue will exhibit an IC50 of about 0.25mM?Refer to the molecular structure of Molecule 1 (attached image). This molecule forms a dimer via pi interactions, resulting to effective molecular stacking. If the molecule can inhibit toxic effects at 0.5mM against gastric carcinoma cells, does it mean that the dimer of this nucleoside analogue will exhibit an IC50 of about 0.25mM?What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’
- In pyrimidine nucleosides, the anti conformation predominates. Explain. Do the purine nucleosides have similar interactions?A mixture of proteins having molecular weights of 50 to 200 kDa can be fractionated linearly using a GFC column with an exclusion limit of at least _____.a. 25 kDab. 50 kDac. 125 kDad. 200 kDapls explain whyWhat is the likely keq for an enzyme that has a deltaG =-18.3kj/mol?
- 2,3-Bisphosphoglycerate lies in a central cavity within the hemoglobin tetramer, stabilizing the T state. What would be the effect of mutations that placed the BPG-binding site on the surface of hemoglobin?You want to treat 10 mL of HL-60 cells with cycloheximide in order to determine the half-life of a newly discovered protein. In order to do this, the final concentration of cycloheximide needs to be 90 µM. How much of a 150 mM stock solution of cycloheximide should you add to your cells?What are the possible sources of errors or deviations between the theoretical andexperimental pKa values for lysine?
- What is the molecular weight of the Botulinum neurotoxin, a protein that contains 1350 amino acids? Assume an average distribution of amino acidsMost bacterial mutants that require isoleucine for growth also require valine.Why? Which enzyme or reaction would be defective in a mutant requiringonly isoleucine (not valine) for growth?5 25) Although the UV280 extinction coefficient of BSA is well known, why was the BCA assay employed to measure protein concentration of the folate labeled BSA? Please provide an explanation. (C) Would the use of reducing agents have an affect on the tertiary structure of BSA—please explain your answer (you will need to investigate the structure of BSA beyond this article)?