In order to make a mRNA strand for the spike protein researchers had to determine the amino acid sequence for the spike. Once that was determined they produced the mRNA for the protein. Part of the spike protein contains the following amino acids: serine, serine, glutamine, cystine, valine, and asparagine. What would be the mRNA strand for this section? (Provide direction for the mRNA by using 5' and 3')

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: During the termination of translation, what is the correct polypeptide sequence which will be…

A: DNA is the storehouse of genetic information. This information age expect by the formation of an…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is a…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: If a polypeptide chain is 30 amino acids, how many nucleotides will make up the coding mRNA strand?…

A: Amino acids are the monomers that join together by peptide bond formed between the carboxyl end of…

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: elow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: DNA and RNA are the genetic material which have the genetic information about perticular organism…

Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' 1. Where N stands for any nucleotide, give…

A: *Given DNA sequence is 3'-TACTTNGTNCTNTCN - 5'  1* Here N will be any nucleotide so take Him place…

Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…

A: DNA is the store house of genetic information. This information is in the form of nucleotide…

Q: What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that…

A: Base sequence of mRNA Amino acid sequence UUG LEUCINE CCU PROLINE AGU SERINE GAU ASPARTIC…

Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…

A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: Which of the following is the definition of a gene?     RNA that delivers amino acids to a ribosome…

A: Introduction A nucleoside and a phosphate make up nucleotides, which are organic compounds. They are…

Q: The length of a particular gene in human DNA, measured from the start site for transcription to the…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5'…

A: Transcription is the process of synthesis of an RNA molecule from the DNA template strand. Where RNA…

Q: Which of the following best describes the initiation of translation? A. The mRNA binds the large…

A:

Q: Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first…

A: DNA DNA is a genetic material from which amino acid sequence or polypeptide chain are made.

Q: Describe the steps necessary to synthesize mRNA fromeach of the following: double-stranded DNA,…

A: The synthesis mRNA from double-stranded DNA requires the enzyme RNA polymerase II, this enzyme will…

Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons.  How…

A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…

Q: What would be the effect on reading frame and gene function if: Two bases were inserted into the…

A: The nucleotide sequence may be DNA (deoxyribonucleic acid) or RNA (Ribonucleic acid). Nucleic acid…

Q: A scientist sequencing mRNA identifies the following strand:…

A: mRNA is termed as messenger RNA. It is a single stranded RNA used in the synthesis of protein.mRNA…

Q: Which of the following statements regarding the genetic code is false? The genetic code is…

A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…

Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: What proportion (in %) of the CFTR gene/DNA sequence is represented in the CFTR mRNA?   The mRNA…

A: The cystic fibrosis transmembrane conductance regulator (CFTR ) gene displays a tightly regulated…

Q: A strand of DNA, TACGCT, serves as a template for mRNA transcription. What would be the correct…

A:

Q: The MRNA produced when the following sense strand DNA sequence is transcribed is: 5'-…

A: The transcription unit is the segment of DNA that takes part in transcription. It is studied under…

Q: The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What…

A: The process of making a copy of genetic information stored in a DNA strand to a complementary strand…

Q: In order to make a mRNA strand for the spike protein researchers had to determine the amino acid…

A: The process of making proteins is called translation. It involves the synthesis of amino acid…

Q: the space below, list the events that would occur during the processing of a primary RNA transcript…

A: In eukaryotes, however, the RNA transcript must undergo processing before it is a functional mRNA.

Q: What would be the effect on reading frame and gene function if:Answer each Two bases were inserted…

A: The nucleotide sequence may be DNA (deoxyribonucleic acid) or RNA (Ribonucleic acid). Nucleic acid…

Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…

A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…

Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?

A: RNA- It  stand for the ribonucleic acid.  is a nucleic acid present in all living cells and in some…

Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'   As following the rules in Genetic code the…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: The codon and anticodon are base-paired together during the process of translation. Which of the…

A: The central dogma of molecular biology involves the transfer of information from DNA to proteins…

Q: Given the following MRNA sequence, what is the amino acid sequence of the polypeptide that will be…

A: The mRNA is read in the 5' to 3' direction by the transcription machinery to produce the polypeptide…

Q: if the sequence of bases in the mRNA Codons is 5' - AUCCUACGU - 3' then the sequence of amino acids…

A: In the central dogma of molecular biology, DNA is converted into mRNA by the process of…

Q: Here is an mRNA sequence (written 5' → 3') A G G G A G G U A A C A G 14 15 16 17 18 19 20 21 24 27…

A: The translation initiation codon is the 5'-AUG-3'. From this codon the first amino acid is…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is composed of nucleotides and it is a double-stranded helical molecule, and each of nucleotide…

Q: In this picture, a tRNA is already bound to the initiator codon at the start of the mRNA strand. The…

A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…

Q: A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon…

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…

A: Translation  It is the synthesis of proteins from the codons present in the mRNA. Anticodons…

Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: In panel a (see picture), a tRNA is already bound to the initiator codon at the start of the mRNA…

A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…

Q: Which of the followings indicate the order of procaryotic mRNA degreadation?   cleavage of the…

A: Messenger RNA (mRNA) acts as the template for protein synthesis. Though mRNA is associated with…

Q: Transcribe the corresponding mRNA strand from the given DNA strand:    DNA:     TAC       GCA…

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid.  It is the genetic material of all…

Q: the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA…

A: an delete the 'C' at position 52   Explanation:  it is the type of frameshift deletion mutation…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.