Answered: DNA sequence

Name: Given the following DNA sequence of the template strand for a given ge
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Given the following DNA sequence of the template strand for a given gene:5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3'Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends).Part B ) Use the

Science

Biology

DNA sequence

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus)
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?