In two of the first three steps of glycolysis: Group of answer choices Phosphorylation reactions occur. Isomerization reactions occur. ATP is converted to ADP. More than one correct response. No correct response.
Q: Upon doing the experiment of Protein Denaturation, what could be observed in the precipitation of…
A: Proteins are composed of chain of amino acids linked by peptide/amide bond which forms the primary…
Q: Draw a lipid exhibiting both an ether-linked and ester-linked acyl group attached to a glycerol…
A: Lipids are made up of fatty acids. they are insoluble in water. Lipids are important constituents of…
Q: Which of the following interactions would be seen between the R-groups of His and Gln at pH 8?…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Xylulose and ribulose are epimer pairs. Please explain why and how to identify epimer pairs
A: Epimers are the simple Sugars that differ in a single chiral centre or in the arrangement of OH…
Q: An enzyme has a single active site at which it can bind and hydrolyze either X or Y; however, the…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…
Q: Consider a membrane that has a very high content of phosphatidic acid on the inner leaflet of the…
A: Introduction Proteins are made up of amino acids. Protein plays various function in our body. Two…
Q: Explain the growing public health threats of emerging zoonotic infections and challenges in…
A: Zoonoses are diseases and infections that are naturally transmitted between humans and vertebrate…
Q: Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine…
A: The Henderson-Hasselbalch Equation for the deprotonation of a species is given below. pH= pKa +…
Q: Mechanism of action of electron transport inhibitors. Antimycin A.
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Which of the following is considered an omega-6 fatty acid?
A: Since animals cannot synthesize omega-6 and omega-3 fatty acids, they must be obtained from their…
Q: Which two statements below accurately describe the roles of insulin and glucagon in maintaining…
A: Glucagon is a hormone secreted by the pancreas that controls the blood glucose level. It prevents…
Q: catabolic pathway - draw the complete electron transport chain for myristate
A: Myristate is 14 carbon saturated fatty acid molecule (molecular formula of CH3(CH2)12COOH), a…
Q: What would be the effect of a visualizing agent on the retention factor. Rf? A.Higher Rf B.Lower RF…
A: Visualising agent: The chemical agents that can be used to detect the number and location of the…
Q: Just 15-3
A: Kequilibrium constant is the ratio of rate of forward reaction and rate of backward reaction and…
Q: Starch is a polysaccharide 1.Is starch positive in Bial‘s test？（what color ？） 2.Is starch positive…
A: Introduction: Polysaccharides are polymers of D-glucose that are joined together by glycosidic…
Q: Draw the structure of alanylserine, a dipeptide made from alanine and serine, as it would appear at…
A: A dipeptide has two amino acid residues. Amino acid sequences are written with N-terminal amino…
Q: In the presence of O₂ and low energy status of the cell, acetyl CoA is oxidized to oxygen O lactate…
A: Acetyl Co A is a two carbon and an important biochemical molecule which is a connecting link of…
Q: A biotech company sells a "reporter assay kit" for researchers to easily find small molecules that…
A: The glucocorticoid receptor is a type 1 hormone receptor. The receptor dissociates from the chaperon…
Q: when v=vmax/2，Km =（S） 1.why？？Need Explaination. What is V and what is Vmax？how is their relationship…
A: In Michael's menton kinetics, Enzymes are known to show Vmax at a particular concentration of…
Q: Please help me calculate BSA and Net Abs (explaination and details pls)
A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…
Q: true/false: Glutamine synthetase is responsible for the synthesis of glutamine from glutamate.
A: Both glutamate and glutamine are non-essential amino acids. These are glycogenic amino acids.…
Q: Ketohexoses commonly exist in living systems in either the straight chain or ring (furanose) forms.…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose.…
A: In the reaction mechanism catalysed by glucokinase, glucokinase binds and brings ATP and glucose…
Q: Imagine that you were asked to denature a protein; you know you can do so using urea. Your protein…
A: Denaturation is the process by which a protein looses it native structure, to the level that protein…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are proteins that act as biocatalysts. Enzymes are classified into six classes based on the…
Q: A plot of enzyme activity with and without an inhibitor present gave the following. Use two…
A: The rates of biochemical reactions are increased by proteins known as enzymes. Inhibitors are…
Q: OOC 1 H₂C H₂C H₂C-C HC H₂C NH NO HN Coo 1 CH₂ T CH₂ C-CH, CH C-CH₂ G=CH₂ "OOC 1 H₂C H₂C T H₂C H₂C-C…
A: Hemoglobin has four subunits, in which each has a heme group. The heme group is a heterocyclic…
Q: Experiment: Lipids Qualitative Tests Test Performed: Translucent Test Procedure 1. Fold your…
A: Lipids are a chemically diverse group of biomolecules with two common characteristics: low…
Q: Which of the following molecular formulas would be for an aldopentose? C4H8O4 C₂H₁408 C6H12O6…
A:
Q: 4. In the space below provide a mechanism for this reaction that proceeds through the intermediate…
A: Glycolysis is the process by which one molecule of 6-carbon glucose is broken down into 2 molecules…
Q: Classify the diluents use with respect to their osmotic pressure in relation to their contents of…
A: Cell membranes are semipermeable barriers, and osmotic gradients between intracellular and…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Denatured protein is in a low energy state. What sort of explanation can you use to rationalize that…
A: Denaturation of protein: When proteins are denaturized, they lose the quaternary, tertiary, and…
Q: Which of these chemicals damages the brain in a way that resembles Parkinson’s disease? A. Capsaicin…
A: Dopamine is a neurotransmitter. It is synthesised by dopaminergic neurons. Parkinson's disease is…
Q: Which of the following results are most likely to be observed in liver enzymes following initiation…
A: When subjected to a prolonged period of starvation, the level of glucose in the blood falls. This…
Q: We eat foods containing sucrose (table sugar), lactose (milk sugar), and cellobiose (disaccharide of…
A: Carbohydrates that are obtained through the diet include monosaccharides, disaccharides, and…
Q: Using Haworth projections, draw the structure of an a-disaccharide of mannose B(1,2) galactose…
A: Carbohydrates or carbs are macronutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: 5. Reciprocal regulation of glycogen phosphorylase and glycogen synthase activity.
A: Enzymes are proteins that aid in the speeding up of chemical reactions. Enzymes bind to substrates,…
Q: The Gs-alpha subunit of trimeric G proteins can function to regulate ion channels. inhibit…
A: Introduction: G-protein is a heterodimeric containing three different subunits named alpha, beta,…
Q: Choose the best answers for each missing word from the list below. ____ regulated by ATP, Aspartate…
A: Enzymes are proteins found in the cell, these are bio catalysts that speed up the reaction without…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…
A: Introduction: An antagonist is a substance that does not cause any biological response itself but…
Q: Show a calculation of change in standard reduction potential that explains why succinate is not…
A: When two half reactions are paired in a redox reaction, the half reaction with the higher E°' will…
Q: What is the isoelectric point of the following peptide molecule?…
A: The pH at which a specific molecule carries no net electrical charge is known as the isoelectric…
Q: Convert 475 cal to joules
A: Calories, joules are used to determine the amount of energy present in the food . The energy given…
Q: true/false: The cofactor ATP is essential in all transamination reactions.
A: Transamination is a reaction which results in transfer of an amino group to a keto-acid in order to…
Q: How do enzymes typically relate to the manipulated variables? our manipulated variables were…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Make a Concept Map about the Amino Acids. Separate them base on Essential, Non-Essential, and…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Provide 3 reactions that facilitate the synthesis of oxaloacetate
A: Oxidation of glucose into pyruvate followed by oxidation of pyruvate into acetyl CoA and then…
Q: Explain how an enzyme could distinguish between the (now circled) equivalent positions in the above…
A: Aconitase is an enzyme that catalyses the conversion of Citrate to isocitrate. Aconitase is an iron…
Step by step
Solved in 2 steps
- Which of the following is NOT true of glycolysis? Select one: a. The pathway requires two molecules of ATP to get started catabolizing each molecule of glucose b. ADP is phosphorylated to ATP c. The pathway converts two molecules of NADH to NAD+ for each molecule of glucose that enters d. The pathway does not require oxygenWhich of the following statement about ATP formation in Glycolysis is True? a. Four ATP molecules are used in the Glycolysis of one molecule of Glucose b. Three ATP molecules are formed in the Glycolysis of one molecule of Glucose c. Two ATP molecules are used in the Glycolysis of one molecule of Glucose d. Two ATP molecules are formed in the Glycolysis of one molecule of GlucoseWhich of the following enzyme catalyzes the first step of glycolysis? Group of answer choices Hexokinase Pyruvate kinase Glucokinase Phosphofructokinase
- ATP is NOT directly produced by which of the following reactions? glycolysis the preparatory reaction the TCA cycle the electron transport chain and oxidative phosphorylation all of these produce ATP directlyWhich of the following is true about Glycolysis? a. endergonic reaction b. site is cytoplasm c. net gain of 4 ATPs d. Energy payoff phase generates FADH2 and ATPIn which step of glycolysis does each of the following occurs? second substrate-level phosphorylation reaction first ATP-consuming reaction third isomerization reaction use of NAD+ as an OA
- Which of the following must be available in sufficient supply for glycolysis to proceed? a. Glucose, NAD+, and ATP b. Pyruvate, NADH, and ATP c. Glucose, NADH, and ATP d. Acetyl-CoA, FAD, and NAD+ e. Pyruvate, NAD+, and ATPWhich of the following processes will result in a direct net increase of ATP concentration? Group of answer choices Anabolic chemical pathways Primary Active transport dehydration synthesis Glycolysis.Which of the following statements about glycolysis is correct? a) Glycolysis is an aerobic process (aerobic) b) Glycolysis takes place in the mitosol c) Glycolysis gives 2 moles of ATP compared to 1 mole of glucose d) Glycolysis cannot be reversed
- In the conversion of G3P into pyruvate at the end of glycolysis, which of the following does NOT occur? electron carriers are reduced inorganic phosphate is added to the carbon structure substrate level phosphorylation resulting in ADP à ATP carbon is released as CO2Which of the following is not a product or reactant of glycolysis?a. NADHb. ATPc. pyruvated. oxygenWhich of the following ideas is NOT TRUE for Glycolysis? A. Glycolysis breaks down glucose into two molecules of pyruvate. B. Glycolysis occurs in the cytoplasm and has two major phases. C. Glycolysis occurs whether or not oxygen is present. D. Glycolysis yields a net of 4 ATP.