Indicate the size in kilobases (kb) of DNA fragment(s) that you would expect to see if you cut a circular plasmid with BamHI recognition sites are at positions 2000bp and 3000bp and the plasmid if 5500bp total?
Q: This plasmid was digested using different restriction enzymes whose sites have been mapped. The…
A: Note: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question…
Q: A microbiologist discovers a new type II restriction endonuclease. When DNA is digested by this…
A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…
Q: A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-…
A: Restriction endonuclease is an enzyme which cleaves DNA into fragments at specific location sites…
Q: You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…
A: Restriction enzymes are molecules that cleave nucleic acid (DNA) at a specific sequence. Restriction…
Q: For some DNAS it is possible to separate the two strands, after denaturation, in a CsCl gradient.…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: 5. 2) Digestion of a 1.1kb fragment of plasmid DNA with BamHl produces two fragments of 700 bp and…
A: BamHI is a type II restriction endonuclease can identify specific restriction site and induce cut on…
Q: A plasmid vector pBS281 is cleaved by the enzymeBamHI (5′ G^GATCC 3′), which recognizes only onesite…
A: Hi there! Since you have posted multiple questions we are answering only first two sub-parts.…
Q: How many microliters of the pGLO plasmid do you need if you want 5 micrograms of DNA and the plasmid…
A: formula used : DNA in ug = (concentration of DNA / pGLO plasmid in ug/ul) ×(volume of DNA in ul)
Q: A circular plasmid of 10,000 base pairs (bp) is digested with two restriction enzymes, A and B, to…
A: in agarose gel electrophoresis we separate DNA bands based on their size.
Q: proteins can interact with DNA through relatively weak forces, such as hydrogen bonds and can der…
A: DNA or deoxyribonucleic acid is the genetic material in all living organisms, both prokaryotes and…
Q: The code word GGG cannot be deciphered in the same way as can UUU, CCC, and AAA, because poly(G)…
A: RNA silencing is the mechanism by which gene expression is negatively regulated by non-coding RNA…
Q: Do the results shown in this figure support the claim? Explain, being specific about what evidence…
A: The bacterial CRISPR-Cas9 immune system is a powerful and versatile genome-editing tool. It holds…
Q: For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the…
A: The complexity of an organism is based on the functioning of its genome. Deoxyribonucleic acid (DNA)…
Q: Give the sequence on the opposite strand for ACGTAT, AGATCT, and ATGGTA (all read 5' to 3'). Are the…
A: Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA) are the two types of nucleic acids forming…
Q: What two basepair changes can occur when G tautomerizes to the enol form? Recall that the…
A: Introduction: Spontaneous mutations result from numerous sources such as errors during DNA…
Q: Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved…
A: DNA polymerase is a member of a family of enzymes that catalyse the synthesis of DNA molecules from…
Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in.......
A: Solution - Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in DNA…
Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…
A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…
Q: Calculate the length of the DNA of bacteriophage lambda that has 48502 base pairs.
A: Introduction: DNA stands for deoxyribonucleic acid and is a form of nucleic acid. Except for a few…
Q: If you repeat the okazaki experiment WITHOUT denaturing DNA, what would be the expected outcome? O…
A: The Okazaki experiment explained that the process of DNA replication is discontinuous and also…
Q: Is it unusual that the β-subunits of DNA polymerase III that form a sliding clamp along the DNA do…
A: DNA pol II is the primary enzyme involved in DNA replication. It is a mutiprotein complex that…
Q: Consider the following plasmid (size 8000 bp), with restriction sites at the positions indicated:…
A: A plasmid is determined as a very small and circular molecule of DNA, which is also double-stranded…
Q: Using the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if…
A: Restriction enzyme are specific DNA cutters and extremely useful while exploring molecular biology…
Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…
A: Gel-electrophoresis:- it is a technique used for the separation of charged molecules such as DNA,…
Q: In DNA and plasmid extraction using the kit method, silica membrane is used. How could the nucleic…
A: Silica based DNA extraction method is an easy and economical method for extracting nucleic acid. It…
Q: Discuss the role of the hydrophobic interactions in stabilizing the following. Q.) Double-stranded…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Q: For linear 34,000 kb DNA calculate a) contour length; b) the length of DNA as packaged in…
A: Introduction "DNA Is A Molecule That Carries And Transmits Hereditary Information Or Genetic…
Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…
A: Gel electrophoresis:- it is a technique through which DNA, RNA, or protein can be separated. When we…
Q: Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA…
A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…
Q: Assume complete digestion of a single linear piece of DNA digested (cut) with EcoRI and Hindill.…
A: A plasmid is a single-stranded, circular DNA molecule that is different from the chromosomal DNA of…
Q: What is the role of GelRed® in Agarose gel electrophoresis of DNA fragments? Please select the…
A: Agarose gel electrophoresis is a method of gel electrophoresis used to separate a mixed population…
Q: A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid…
A: Plasmids are small, circular, double stranded, and extrachromosomal bacterial DNA. i.e. it is…
Q: Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was…
A: Pyrosequencing is a form of sequencing that works by the principle of DNA replication. The template…
Q: Forming nucleosomes and wrapping them into a 30-nm fiber provide part of the compaction of DNA in…
A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…
Q: U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…
A: A restriction endonuclease or restriction enzyme is a bacterial enzyme that cuts dsDNA into…
Q: You have used the technique of chromatin immunoprecipitation to isolate DNA fragments containing a…
A: In chromatin immunoprecipitation assay (ChIP) first tissue or cells are fixed with the help of…
Q: RNA polymeraze binds 100x quicker to the promotor when the promotor is in a 8kb plasmid than to the…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleotide…
A: DNA sequencing: It is the biochemical method used to determine the sequence of the nucleotide bases…
Q: Would you expect to find nuclear localization sequences(NLSs) in the proteins that make up…
A: A nuclear localization sequence is an amino acid sequence that aids in protein transport (import)…
Q: Compare the DNA binding modes of minor groove binding, intercalating, and crosslinking agents and…
A: The new drugs used in most cancer diseases and other diseases are DNA intercalating and minor groove…
Q: Using the formulae for dsDNA to calculate g/mol: You have a 4110 bp cloning vector Want to ligate a…
A: The average weight of a single DNA bp is 650 daltons. This can also be represented as 650 g/mol (=…
Q: Explain why DNA fragments migrate in a gel electrophoresis. Which fragments migrate farthest: large…
A: Introduction :- The technique of gel electrophoresis is used to separate DNA fragments based on…
Q: The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the…
A: So, for choosing the primers for PCR, following requirements must be fulfilled :- 1. It should be…
Q: 1. You have a circular plasmid (PUC57), which consists of 2710 bp. What would the number and length…
A: If we cut a circular plasmid at 2 sites then 2 fragments would be generated. Similarly, for 3 cut…
Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…
A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…
Q: How often, on average, would you expect a restriction endonuclease to cut a DNA molecule if the…
A: Restriction endonucleases are enzymes that function like molecular scissors. They cut the…
Q: In sea urchin DNA, which is double stranded, 17.5percent of the bases were shown to be cytosine (C).…
A: Chargaff's rule expresses that DNA from any organism ought to have a 1:1 stoichiometric proportion…
Q: Calculate how you would make 100 ul of a 2 pg/ul plasmid solution from a 5 ug/ul stock. If it is a 5…
A: The conversions required to solve this question are; 1 pg= 10-12g1 μl= 10-6l The product of Molarity…
Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…
A: Introduction Micrococcal nuclease in as example of endo-exonuclease which is obtained from…
Indicate the size in kilobases (kb) of DNA fragment(s) that you would expect to see if you cut a circular plasmid with BamHI recognition sites are at positions 2000bp and 3000bp and the plasmid if 5500bp total?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- You digest a 5 kb plasmid with two enzymes that yield fragments of 4 kb and 1 kb. After running the digest on a gel, what would you predict to see in terms of the intensities of the bands?Calculate how you would make 100 ul of a 2 pg/ul plasmid solution from a 5 ug/ul stock. If it is a 5 Kb plasmid and we want to take 1,000 molecules, how many ul of the diluted solution do we need? The average molecular weight of DNA base is 325.Compare the melting temperature of a 1-kb segment of DNA containing20% A residues to that of a 1-kb segment containing 30% A residues under the same conditions.
- For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the DNA as packaged in nucleosomes with linker histones present.RNA polymeraze binds 100x quicker to the promotor when the promotor is in a 8kb plasmid than to the same promotor on a 200bp linear segment. Assuming that the incubation is performed with equal concentrations of the two types of DNA, explain this difference.When a segment of DNA containing either aVNTR or an RFLP is analyzed, the result is fragments of DNA ofdifferent lengths. How, then, are VNTRs and RFLPs different?
- The temperature at which a DNA sample denatures can be used to estimate the proportion of its nucleotide pairsthat are G- C. What would be the basis for this determination, and what would a high denaturation temperature for aDNA sample indicate?Write down the basepairs of double-stranded ONA that is generated at the joint between a plasmid that is digested with Xhol and a DNA fragment that is digested with Sall and joined by DNA-ligase. Indicate the 5'-and 3'- termini of each strand.You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 5’-ACTGGCACAGAACAGGCACTTAGGAATGAATGAATGAATGAATGAATGAATGACCTGTGTGGTTCCCAGTTCCTCC-3’ 3’-TGACCGTGTCTTGTCCGTGAATCCTTACTTACTTACTTACTTACTTACTTACTGGACACACCAAGGGTCAAGGAGG-5’
- Would you expect to find nuclear localization sequences(NLSs) in the proteins that make up prokaryotic and eukaryotic DNA and RNA polymerases? Explain why orwhy notA researcher has isolated a restriction endonuclease that cleaves at only one particular 10- basepair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain.Compare and contrast the effect of using large pore size (low %agarose) vs. small pore size (high% agarose) agarose fel on the effect of the DNA fragments seperation?