5. 2) Digestion of a 1.1kb fragment of plasmid DNA with BamHl produces two fragments of 700 bp and 400 bp. Digestion of the same 1.1kb fragment with Xhol produces two fragments of 300 bp and 800 bp. Digestion with both enzymes produces three fragments of 100 bp, 300 bp, and 700 bp. Which of the following statements is true about the DNA fragment? A) The Xhol site is located within the BamHI 700bp fragment. B) The BamHl site is located within the Xhol 300bp fragment C) The BamHl site is located within the Xhol 100bp fragment. D) The Xhol site is located within the BamHI 400bp fragment.

5. 2) Digestion of a 1.1kb fragment of plasmid DNA with BamHl produces two fragments of 700 bp and 400 bp. Digestion of the same 1.1kb fragment with Xhol produces two fragments of 300 bp and 800 bp. Digestion with both enzymes produces three fragments of 100 bp, 300 bp, and 700 bp. Which of the following statements is true about the DNA fragment? A) The Xhol site is located within the BamHI 700bp fragment. B) The BamHl site is located within the Xhol 300bp fragment C) The BamHl site is located within the Xhol 100bp fragment. D) The Xhol site is located within the BamHI 400bp fragment.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 12TYK

See similar textbooks

Similar questions

If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
What is an Okazaki fragment? In which strand of replicating DNA are Okazaki fragments found? Based on the properties of DNA polymerase, why is it necessary to make these fragments?
A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bp
(a) What two enthalpic factors stabilize DNA in double-helical form at lowtemperature?(b) What entropic factor destabilizes helical DNA at high temperature?(c) Why is the double-helical structure of DNA stabilized at moderate tohigh ionic strength?
In the Meselson-Stahl experiment on DNA replication, what fraction of the DNA was composed of one light strand and one heavy strand ("hybrid") after one generation of growth in medium containing 14N? After two generations of growth in a medium containing 14N? What fraction of hybrid DNA is expected after n generations of growth in a medium containing 14N?
2b) If you denatured the random 1000 bp fragments of potoroo DNA by heating them to 95°C. and then cooled them down to 60°C and allowed them to reanneal, you would find that approximately 20% of the DNA fragments renatured very rapidly, another 30% of the DNAfragments renatured moderately rapidly, and the remaining DNA fragments renatured relatively slowly. From these results, whatfraction of the potoroo genome is composed of highly repetitiveDNA? helpful Information
How often, on average, will the endonuclease AluI, which cleaves the sequence 5’ AGCT 3’, cut normal DNA (assume equal amounts of each base)? (In other words, what will the average fragment size be after cutting?) Group of answer choices 256 bases 12 bases 40 bases 16 bases none of these
What is meant by the term semiconservativereplication? What are the functions of DNA Pol I and III,helicase, and primase? How does a leading strand differfrom a lagging strand?
A PCR reaction was performed to amplify the XULA3 gene, which is bp 882-5,364 on a plasmid that is 11,719 bp. After the PCR, the product was digested with XhoI. There are XhoI sites on the plasmid at bp 1,434, 4,655, and 7,368. Calculate the size(s) that would result when the product is digested with XhoI. Then enter the size of the largest fragment (in bp).
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally, with both BamHI and HpaII together. Fragments of the following sizes were obtained from this reaction: BamHI: 20-kb, 6-kb, and 4-kb fragments Hpall: 21-kb and 9-kb fragments BamHI and Hpall: 20-kb, 5-kb, 4-kb, and 1-kb fragments Draw a restriction map of the 30-kb piece of DNA, indicating the locations of the BamHI and HpaII restriction sites
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?