Invasive species fishzilla

Q: Explain why populations change over time.

A: Population change is simply defined as the change in the number of people in a specific area over…

Q: Stream invertebrates that break large pieces of allochthonous DOM into smaller pieces are referred…

A: Introduction Organic matter:- It is anything that contains carbon compounds that were formed by…

Q: Chromosomes contain- (A) Protein only (B) DNA and protein (C) DNA, RNA and histone (D) DNA, RNA,…

A: Introduction - DNA is bundled into thread-like structures called chromosomes in the nucleus of each…

Q: The ant-aphid mutualism has become so advanced all of the following traits have evolved in aphids…

A: Ants and aphids have a mutualistic relationship. Aphids devour the plant sap and excrete sugary…

Q: List down several concepts that the society or human being benefit from biodiversity.

A: Biodiversity is the different types of life forms that we see around us. It includes species as well…

Q: Soil pH affects availability of nutrients for root absorption. The following statements are true…

A: The pH is also known as the potenz of hydrogen or in simpler terms, the power or concentration of…

Q: Do the many “dead” transposonsin the human genome provide anybenefits to humans?

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: One indication of the relative importance of various ATP-producing pathways is the Vmax of certain…

A: Given: Vmax of pigeon and pheasant, the enzymes such as Hexokinase, Glycogen phosphorylase,…

Q: 5) Snake venom surprisingly has been a found to be a rich source of biologically active peptides.…

A: Introduction - Snake venom is a very toxic saliva that contains zootoxins and is used to immobilise…

Q: what would happen if the blue crabs population increased substantially/

A: The sapphire-colored claws of the blue crab give it its name. In mature females, the shell, or…

Q: State the primary function of the respiratory system. Name functions of the skin (give 3) Name the…

A: Respiratory system refers to the network of tissues and organs that enable us to breathe and…

Q: Section E. The Secondary Tissues of Roots in Woody Dicots Identify and label these parts in old…

A: Introduction In vascular plants, a vascular bundle is a component of the transport system. The…

Q: What regions of the skeleton may be most useful for determining the sex of the individual from the…

A: Ans is- PelvisIn

Q: Which is common between aerobic respiration and anaerobic respiration ? (A) Similar substrate (B)…

A: Introduction - Respiration can be divided into two categories: Respiration that occurs in the…

Q: Which of the following statements best describe the equation P = G + E + (G X E)?*   a. The…

A: Introduction  The term "phenotype" refers to an organism's visible physical characteristics, such as…

Q: How does the evolution of endodermis, lignified cell walls, sclerenchyma, vascular tissues, true…

A: Vascular plants are those plants it causes vascular tissues for the transfer of substances. Vascular…

Q: How do the following types of viruses replicate (where does replication occur within the host cell,…

A: Viruses are the most cunning organisms and can be really harmful once it enters into the body. The…

Q: What is the problem in the article "Stopping pandemics before they start: Lessons learned from…

A: Introduction Pandemics:- It is the worldwide spread of a new disease, it is an outbreak of disease…

Q: Types of Reproduction (Sexual or Asexual) Organisms Method of Reproduction 1. Hydra 2. Banana 3.…

A: Budding is hydras' most frequent asexual reproductive technique. Buds emerge from the point where…

Q: Human immunodeficiency virus (HIV) preferentially destroys CD4+ cells. Specifically, what effect…

A: Introduction Human immunodeficiency virus (HIV):- It is a retrovirus that when infects a person…

Q: Hello I need one more main point for my third medical paragraph about the uses of marijuana in…

A: INTRODUCTION Marijuana (cannabis) is a dried, shredded leaf, stems, seeds, and flowers combination…

Q: How do populations (or strains) of microbes evolve resistance to antimicrobials? (For this question,…

A: Introduction Antibiotics are antibiotics that are used to treat bacterial infections in humans and…

Q: There are four bones of various types in the body. Name the three divisions (parts of the ear).

A: Introduction Bone:- It is living tissue that makes up the body's skeleton, It is made up of…

Q: From the following list, which group  has many members with woody, perennial stems that show annual…

A: Equistem is basically the only genus left of subclass equisetidae. Also this is referred as living…

Q: Nature Picture Library Aristolochia old stem, x.s.

A: Monocots plants are that contain single cotyledons in the seed while the dicot has two cotyledons in…

Q: Identify and discuss three important patternsof disease in the world’s developing countries

A: Pattern of diseases refers to that happening in different events by whether it is place, time or…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: Introduction :- A nucleic acid sequence is a series of bases denoted by a set of five letters that…

Q: 12. The CFTR gene, on hu chloride ion concentrat cystic fibrosis. How ma In G1 of the cell cycle In…

A: Phase Number of gene/chromosomes G1 phase of cell cycle- 2 copy G2 phase of cell cycle…

Q: Write an essential information about the topic: HOME QUARANTINE AND ISOLATION: Decreasing contact

A: While dealing with a contagious disease certain important guidelines and practices need to be…

Q: Pathogens have a variety of traits that interact with a host and enable the pathogen to enter a…

A: A pathogen is an organism that is capable of causing disease in an organism. It is also known as an…

Q: What factors influence the choice of a horse breed to buy? Draw a sketch of a horse and show the…

A: Light horse The light horse is the breed of horse that has more action and speed rather than other…

Q: 160 140 120 100 80 60 40 20 1845 1865 1885 1905 1925 Time (years) (a) Based on the graph, identify…

A: The relationship between the lynx and the snowshoe hare is a classic example of the predator-prey…

Q: Describe 5 examples of biological processes that can cause DNA supercoil?

A: Supercoiling This process takes place to relieve the helical stress in the molecule through twisting…

Q: The first juvenile larva of Ascaris is known as- (A) Filiform larva (B) Rhabditiform larva (C)…

A: Introduction - Humans have a "giant roundworm" called Ascaris lumbricoides, which can grow to be 35…

Q: uestion 6 hich conditions would NOT lead to good preservation of a dead hominin skeleton? Dying in a…

A: Erect posture, bipedal mobility, larger brains, and behavioural features like as specialised…

Q: SPR is one of many techniques to examine binding affinities of biomolecules. Choose another…

A: SPR is a signal peptide that can arise from the exit site of the ribosome and forms the ribosome SRP…

Q: Suppose that recessive deleterious allele is found to be much less common than its predicted…

A: Introduction The phenomenon of dominance occurs when one variant of a gene on one copy of a…

Q: 1.Why is mitosis also referred to as the equational division? 2. Where does the spindle fibre…

A: There are two type of cell division, mitosis and meiosis. Most  when people talk about "cell…

Q: How does the genus name of Diphyllobothrium latum reflect the appearance of the scolex?

A: Introduction Diphyllobothrium is a tapeworm genus that can cause diphyllobothriasis in humans if raw…

Q: Turpentine oil is obtained from- (A) Coal (B) Petroleum (C) Cedarwood (D) Pinus

A: Introduction - Turpentine is a liquid produced by distilling resin from living trees, primarily…

Q: A 35 year old female saw her doctor complaining of headaches, dizziness and nausea. The headaches…

A: Introduction Anemia:- It is defined as a low number of red blood cells, this reduces the person's…

Q: What role does the human microfauna play in protecting humans against pathogens? (At this point in…

A: The human host and its microbial flora form a complex ecosystem whose balance is a striking example…

Q: Based on his phenotype muggle, with the information provided, can we tell what Dudleys second allele…

A: Inheritance or heredity is passing-on one trait from the parents to the progeny by either asexual or…

Q: 4. Write short notes on Ribosome.

A: Introduction - The site of protein synthesis in the cell is the ribosome, which is an intercellular…

Q: Explain the monocarpic fruits with example.

A: Monocarpic Plants Flowering plants that produce flowers and seeds once in their life span. They are…

Q: G E /99 Livingstone BIODIDAC Livingstone BIODIDAC Figure 2. Frog's Internal Anatomy (Part 1) Figure…

A: To identify: To identify the body parts of the frog from the given frog's internal anatomy diagram.…

Q: worm Disease Produced Infective stage Mode of Transmission Intermediate and definitive host enolepis…

A: Hymenolepis nana and dimunita are the species of tapeworm. H. dimunita has slightly bigger eggs and…

Q: 42)There is but a single enzyme-catalyzed reaction in the human body known to generate carbon…

A: Enzyme is a biomolecule which converts substrate into product by reducing activation energy of…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Medium/test Used Positive result Negative result Comments/ additional info Indicators, for/determine…

A: Microbes are living organisms that are very small and can be seen only with the help of a…

Conservation Biology

The study of how to prevent the loss of biological diversity on the planet is called conservation. Biological diversity, also termed biodiversity, consists of various life forms found in a specific location or across the entire planet, including ecosystems, species, populations, and genes. Conservation thus aims to protect the diversity of life at all levels of biological organization.