5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 -5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your MRNA into an amino acid sequence. Begin at the first codon. Second position Third position (3'end) First position (5'end) A. UAU Tyr UAC Tyr UAA Stop UAG Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser UUU Phe -F UUC Phe UUA Leu FL UUG Leu UCA Ser UCG Ser CGU Arg CGC Arg CAU His CCU Pro ССС Pro CCA Pro CCG Pro H. CUU Leu CAC His CAA Gln CAG Gin -R CGA Arg CGG Arg CỤC Leu A -L CUA Leu CUG Leu U AGU Ser AGC Ser AAU Asn AUU Ile AUC lle AUA lle AUG Met M ACU Thr ACC Thr ACA Thr AAC Asn. AAA Lys K. AAG Lys -- AGA Arg FR AGG Arg ACG Thr GUU Val GUC Val GCU Ala GCC Ala GAU Asp -D GAC Asp_ GGU Gly GGC Gly -V GUA Val GUG Val -A GCA Ala GCG Ala GAA Glu -E GAG Glu -G GGA Gly GGG Gly Basic Acidic Stop codon Polar Nonpolar Adapted from Dr. V. Evans
5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 -5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your MRNA into an amino acid sequence. Begin at the first codon. Second position Third position (3'end) First position (5'end) A. UAU Tyr UAC Tyr UAA Stop UAG Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser UUU Phe -F UUC Phe UUA Leu FL UUG Leu UCA Ser UCG Ser CGU Arg CGC Arg CAU His CCU Pro ССС Pro CCA Pro CCG Pro H. CUU Leu CAC His CAA Gln CAG Gin -R CGA Arg CGG Arg CỤC Leu A -L CUA Leu CUG Leu U AGU Ser AGC Ser AAU Asn AUU Ile AUC lle AUA lle AUG Met M ACU Thr ACC Thr ACA Thr AAC Asn. AAA Lys K. AAG Lys -- AGA Arg FR AGG Arg ACG Thr GUU Val GUC Val GCU Ala GCC Ala GAU Asp -D GAC Asp_ GGU Gly GGC Gly -V GUA Val GUG Val -A GCA Ala GCG Ala GAA Glu -E GAG Glu -G GGA Gly GGG Gly Basic Acidic Stop codon Polar Nonpolar Adapted from Dr. V. Evans
Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna
Section: Chapter Questions
Problem 15QP: Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw...
Related questions
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution!
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning
Biology Today and Tomorrow without Physiology (Mi…
Biology
ISBN:
9781305117396
Author:
Cecie Starr, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning
Biology Today and Tomorrow without Physiology (Mi…
Biology
ISBN:
9781305117396
Author:
Cecie Starr, Christine Evers, Lisa Starr
Publisher:
Cengage Learning