See image 2. The following is the sequence of a gene encoding a small protein:GG (d)AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT5'3'Ċ (c)3'5'c) Suppose that a C becomes permanently inserted into the position shown due to a mistake during replication. Whatwill the sequence of the protein be now?

Transcription is a process in which mRNA is synthesized with the help of DNA by the help of the…

is i 5' AACGATGCCATCAGAGCCCAGGACGTGATTTAA TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT Ċ (c) wha 3' 5' se that a C becomes permanently inserted into the position shown due to a mistake during replication. What e sequence of the protein be now?

is i 5' AACGATGCCATCAGAGCCCAGGACGTGATTTAA TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT Ċ (c) wha 3' 5' se that a C becomes permanently inserted into the position shown due to a mistake during replication. What e sequence of the protein be now?

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 7TYU: The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively...

See similar textbooks

Related questions

Q: Which of the following levels of organization is arranged in the correct sequence from most to least…

A: Ecosystem: An ecosystem is a broader concept that encompasses both living (biotic) and non-living…

Q: In dosage compensation, do males sometimes overcompensate or is it always Barr body X-chromosome…

A: Dosage compensation is the process by which the organisms equalizes their genetic expression between…

Q: What is the Main Point of Figure a? What is one of the main points of Figure B [Choose ] [Choose ] >

A: Heat shock protein :Heat shock proteins (HSPs) are a class of proteins produced by cells in response…

Q: Which of the following statements accurately describe how solutes affect a vesicle made of a…

A: Lipid bilayer is selectively permeable and here the membrane is allowing the water to pass and not…

Q: H 10 Regional Plankton Biomass W Malay 1980s 1990s Year -Middle Atlantic Bight -Georges Bank MA…

A: Gulf of Maine is one of the most dynamic , diverse and unique environments. Frequent tides keeps on…

Q: CASE ANALYSIS Case: An 81 year old female brought in by her son for a medication evaluation. Her…

A: In this case, the patient is an 81-year-old female with a complicated restorative history and an…

Q: Cells are inherently dynamic systems characterized by multiple, low-affinity interactions between…

A: Answer :- In biology , the term "stasis" is of particular significance. It represents a fundamental…

Q: Place the following terms or examples with the correct category. Glycosaminoglycans Chondroitin…

A: Glycosaminoglycans, proteoglycans are the components of cell matrix and cell surfaces. These help in…

Q: D G A C E B F H

A: In phylogeny, clades represent groups of organisms that share a common evolutionary ancestor. They…

Q: How is transport mechanism vital in a cell?

A: The transport mechanism is the transfer of chemicals into or out of a cell across the cell membrane.…

Q: O Intron O Exon O 5' Cap O Poly A tail O Promoter O Terminator

A: These are the essential components of the genetic code that encodes for building proteins and…

Q: Which of the following concept maps correctly describe the relationship among these four terms -…

A: Genomic is field of study which is used in order to comprehend the structure as well as the function…

Q: You isolate a cell from a yeast species (a eukaryote) where n = 8, apply a chemical that forces…

A: Cell cycle is the series of events that take place in a cell. During the cell cycle, a cell prepares…

Q: In Drosophila, the white gene located on the X chromosome affects eye color; an autosomal gene,…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: edigree and determine which of the following modes of inheri ait: dominant recessive minant essive…

A: A pedigree is made on different modes of inheritance that could be autosomal or sex linked.…

Q: ing independent assortment, what phenotypic ratio would you expect to see if individual with the…

A: When an individual with the genotype R/r,G/g is self-crossed, you need to consider the independent…

Q: Explain how knowledge of the energy content of food can help dietetics make smart food choice?

A: Answer :- Knowledge of the energy content of food plays a pivotal role in the field of dietetics, as…

Q: Protein processing pathway Match each description with the appropriate step in protein secretion.…

A: Proteins are produced by the ribosome by the translation process. Ribosomes bound on the membrane of…

Q: In the "Epidemic of Absence" critique the book, explain in details microbiome and summarize in…

A: The microbiome is a complex and diverse community of microorganisms that live within and on the…

Q: Given the expected phenotype probability that you determined above, what is the minimum number of…

A: To calculate the expected number of offspring with the AB phenotype, you can use the product rule of…

Q: The doctor orders 3 mcg/kg/min of sodium nitroprusside. The stock supply is 100 mg of sodium…

A: Sodium nitroprusside is used in medication to manage acute hypertension. It is a potent vasodilator…

Q: Question 8 Myoglobin and the subunits of hemoglobin have: O very similar primary and tertiary…

A: Hemoglobin is an iron-containing protein, present on the surface of RBCs and carries oxygen from…

Q: of Procedure: "as given" Data Table: Molarity in bag 0 (H₂0) 0.2 M Sucrose 0.4 M Sucrose 0.6 M…

A: To calculate the percentage change in mass, divide the change in mass by the initial mass, then…

Q: e figure below shows an insect, pelican, and a magnolia tree. Please select at has the trait that is…

A: Cicadas show a extended life cycle with reproducing only once in their lifetime.Annual life cycle is…

Q: Determine the type of hemolysis displayed on this blood agar plate. Drag the appropriate label to…

A: Red blood cell destruction is referred to as hemolysis. Some microbes are categorized based on their…

Q: species, 30 Paramecia were found in 4 mL of sample pond water. At another location, 85 Paramecia…

A: We know that microorganisms are everywhere. Ponds are places where microbes thrive . Sometimes it's…

Q: The ancestors of seed plants are thought to have been heterosporous. In modern day gymnosperms,…

A: Algae are the first photosynthesizers to arrive. Later on algae helped in the development of new…

Q: Bacterial cells that are longer than wider in cellular morphology, can grow in the presence or…

A: Bacteria are prokaryotic organisms that are found in diverse habitats. Based upon their requirement…

Q: Consider the following in light of the concept of levels of structure (primary, secondary, tertiary,…

A: Proteins are made up of monomer units called amino acids that adjoin via peptide linkage leading to…

Q: Why does the presence of double crossovers allow for underestimation of recombinant frequency?

A: The possibility of genetic recombination between 2 loci on a chromosome occurs during meiosis, and…

Q: What is the reasoning for ALP values in young adults and chidlren being double the values of adults.…

A: ALP is an enzyme found in various tissues in the body, including the bones, liver, and intestines.

Q: 11. Fill in the chart below comparing active transport, diffusion, and facilitated diffusion. 6…

A: The cell uses a variety of mechanisms to transfer materials into and out of it. Simple diffusion is…

Q: Identify the number of amino acids per 360o turn of an alpha helix. Given this information, how many…

A: Proteins are composed of higher folding of linear chain amino acids adjoined via peptide linkages.…

Q: ส individual plants were collected from nature (thus not necessarily pure breeding) before flow-…

A: A single character is involved in all these crosses hence it is a monohybrid cross. In this cross…

Q: What effect does a high carbon level have on the deep ocean? Why might it be important to keep an…

A: A high carbon level in the deep ocean can have several effects:Ocean Acidification: Elevated carbon…

Q: Name Zona A Fill in the lodowing statement Dut is the movement of Osmosis BEAKER 10% BEAKER #2 CELL…

A: The process by which water (solvent) moves from higher water potential area to the lower water…

Q: Rank these amino acids from most to least hydrophobic. COO™ COO™ çoo

A: Think of amino acids as characters in a story. Leucine is the 'shy' one who avoids water, so it's…

Q: Calculez: 0.02cm+3.72mm+0.024m+230µm. Give the answer in mm (do not round off your answer, write…

A: A micrometer, often called a micron, is a unit of length in the metric system, symbolized as µm. It…

Q: 4) Listen are channels between cells that aid in communication Odesmosomes gap junctions Tulear…

A: Here, the correct answer is B) Gap junctions.

Q: A Membrane potential (V) +50 mV +25 mV Omv -25 mV -50 mV - Open - Closed - Open - Closed - Closed…

A: Answer :- The provided graph illustrates the current generated by a voltage clamp protocol through a…

Q: The best definition for resolution is: O The ability of an organelle to pick up stain The thickness…

A: Resolution in microscopy is a critical concept because it determines the ability of a microscope to…

Q: When writing a scientific report there is no need to report and if percentages are being reported.…

A: A scientific report is a written summary of a scientific research's methodology, developments,…

Q: what is the pathophysiology of ditributive shock

A: Distributive shock, a critical medical condition, is characterized by a profound disturbance in the…

Q: cell that reabsorbs bone material in order to repair cracks and supply calcium to the blood cushions…

A: Bones, muscles and joints along with tendons, ligaments, cartilage and connective tissues together…

Q: 1 ㅇㅁㅁㅇ ㅇㅁㅇㅁ

A: Inheritance pattern is a pattern which determines how traits are passed from parent generation to…

Q: Parietal cells acidify the stomach contents while maintaining a neutral cytosolic pH by: O exporting…

A: The human digestive system relies on a specific cell type known as parietal cells. Parietal cells…

Q: The matching questions below refer to this figure: (relative change) 3.00- 2.00- 1.00 - low N, heat…

A: Answer :- In the context of the experimental data and figure provided, we are examining the role of…

Q: otein? the mutation of a surface glu to an asp the mutation of an interior val to an ile the…

A: It is the clumping or misfolding of proteins. It can have adverse effects on the structure and…

Q: Tendel's Law of Independent Assortment? Explain your reasufillig in your own words. AB Ab aB ab AB…

A: In the Punett square a dihybrid cross is shown where two traits are considered at a time. Each…

Q: Viruses without borders" is what it means? What's the reason that viral infections are going up as…

A: Viruses without borders" means that viral infections don't respect geographical boundaries. They can…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

See image

2. The following is the sequence of a gene encoding a small protein:
GG (d)
AACGATGCCATCAGAGCCCAGGACGTGATTTAA
TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
5'
3'
Ċ (c)
3'
5'
c) Suppose that a C becomes permanently inserted into the position shown due to a mistake during replication. What
will the sequence of the protein be now?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Explaining transcription and translation

VIEW

Step 2: Explaining the proteins sequence formed by the given DNA sequence

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively demonstrated that DNA (a) is a double helix (b) replicates semiconservatively (c) consists of repeating nucleotide subunits (d) has complementary base pairing (e) is always synthesized in the 5 3 direction
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
4. How many codons are there in the mutated DNA - (b) and DNA - (c)?
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. Discuss the difference between intron and Exon
1. Why is the specific base pairing is essential to the processes of transcription and translation? 2. How is protein made out of a RNA template?
1. Why is that DNA polymerase and RNA polymerase can synthesize polynucleotides only from 5' to 3' to direction?
4. If a DNA triplet is CGA A. What is the mRNA codon? B. What is the tRNA anticondon? C. What amino acid does the mRNA code for? 5. If 18% of the nucleotide bases in a DNA molecule are Guanine (G) A. What % of the bases are cytosine (A)? B. What % of the bases are adenine (A) and thymine (T) combined? C. What % of the bases are thymine alone?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.