Discuss the difference between intron and Exon

Q: 38/ 50 Translation reques A mRNA tRNA and rRNA 8 mRNA DNA and rRNA C. mRNA, IRNA, DNA, and rRNA D…

A: Translation:  It is the process of synthesis of protein from mRNA transcript by transferring the…

Q: C 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…

A: DNA is ladder like , two strand structure that act as genetic material in most of Organism.…

Q: 6. Please describe the events that may result in a mature protein not having methionine as the…

A: DNA is the carrier for genetic information in almost all organisms except certain RNA viruses. DNA…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: 17. The genetic code

A: The above given statement is about genetic code.

Q: an amino acid has a codon that ends in a pyrimidine, which of the following is not necessarily true?…

A: One of the most important property of genetic code is the code is degenerate. This means that a…

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: Codons are recognized by O DNA polymerase and a codon O FRNA and a codon O TRNA and an anticodon O…

A: Codon is a sequence made of DNA or RNA which corresponds to a particular amino acid.Genetic code is…

Q: 1. What are the amino acids translated from the resulting mRNA?

A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…

Q: 2: Translation Translation MRNA Codon Amino Acid GAA Glu ACG GAU UAC CAG CCC AUG GGC

A: Translation includes the decoding of the information in the mRNA (messenger RNA) into the functional…

Q: 1. DNA MRNA AUG A CU AG C UG G G GG UAU UA C UUU UAG tRNA AA

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG....3' a. Use the genetic code to predict the amino acid…

A: DNA is the genetic material as it contains all the information required to make all the proteins and…

Q: 2. Identify the following structures when given images such as the ones below: ● process of…

A: Introduction The cell is the basic structural and functional unit of life present in all living…

Q: 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what…

A: Transcription  is defined as the synthesis of mature mRNA from antisense DNA template. Translation…

Q: 2. What would happen if a mutation in DNA changed codon 6 in the MRNA to GUA? (This one nucleotide…

A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as…

Q: 2. [1] Which of the following are NOT necessary components of a. Anticodon b. Polymerase c. Ligase…

A: when the process of transcription completed of DNA to RNA in the nucleus of the cell, ribosomes in…

Q: 1: Transcription Transcription DNA nucleotides TAC АСА GAT TTT GTC ACT АТА MRNA codon AUG

A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: 20. Initiation and elongation in translation requires         A ATP         B.TTP…

A: The translation is the process of protein synthesis in the cell. It takes place in the cytoplasm of…

Q: 1. Research on how are hydrogen bonds involved in the transfer of genetic information? CITE YOUR…

A: DNA and RNA are nucleic acids, which are large linear polymers that hold data in a format that can…

Q: 2. Describe the process that is occurring in this image protein nibosome

A: The proteins are the final product of a gene that perform all the functions within the cell.…

Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA

A: Ribonucleic acid (RNA) is a genetic material that is prepared from the deoxyribonucleic acid (DNA)…

Q: 2. The sequence of bases in a segment of mRNA is UUUCAUAAG. Answer the following questions: a. What…

A: mRNA is the transcript that is produced during the process of transcription from DNA by the enzyme…

Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…

Q:

A: Purines is equal to pyrimidines. So  A=T C=G

Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation

A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…

Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA.

A: 7. In all living organisms, the material that  contains  the information which is transmitted from…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…

A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…

Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTY by Smith 4th Edition

A: mRNA or messenger RNA is a polymer of ribonucleotides that has a sequence corresponding to the…

Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…

A: The central dogma of molecular biology involves the processes of transcription and translation that…

Q: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: 4. Compare DNA and RNA as to structure and components.

A: Biological molecules or the biomolecules, are the substances that are produced by cells and living…

Q: 9. What is the role ol RNA polymerase? To answer the question please: 1) name three types of RNA in…

A: RNA: It is made up of repeating strands of nucleotides which contain all the three parts (nitrogen…

Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…

A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…

Q: How are nucleotides formed?

A: Hi! As you have posted multiple questions and have not mentioned which is to be answered, we are…

Q: 1. Decoding mRNA into amino acids is called translation.

A: above given statements are about transcription, translation process and how amino acids makes a…

Q: C A T A C G C G T A с G

A: The given figure shows the process of DNA replication. DNA replication refers to the process of…

Q: Discuss the roles of exons and introns.

A: A gene is the basic physical and functional unit of heredity. Genes are made up of DNA and each…

Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…

A: Transcription is the process where the genetic information on the DNA strand is transferred into an…

Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…

A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…

Q: In 2 paragraphs. Discuss the differences between RNA and DNA, in terms of structure and function.…

A: The two important nucleic acids, DNA and RNA have some major differences based on their structure…

Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 1.  The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase.…

A: Answer:-  The process in which the peptide bonds formation occur in between the ribosome called…

Q: 1) The direction of transfer of genetic information in all living things (as defined in the central…

A: it is the process of conversion of the DNA into the functional product it explains how genetic…

Q: Which of the following carries amino acids?

A: Ribonucleic acid (RNA) is a single stranded nucleic acid found in all living cells. Its different…