Is it useful to learn about modern hunter-gatherer groups in order to understand early societies

Q: What is the role of nerve rings

A: A nerve ring is a ring of concentrated nervous tissue around the pharynx or oesophagus of many inver...

Q: Diagram by Punnett square a cross between individuals with the following genotypes: A/a×A/a; A/a B/b...

A: Punnet square is a visual representation of a cross between the individual where the gametes are den...

Q: Meausre length of A table A tile or brick The diameter of a spigot or nozzle The nearest rock One pi...

A: Metric system is a system of measurement that uses the meter, litre, and gram as base units of lengt...

Q: ___________________ stabilize the structure of DNA and proteins.

A: Biomolecules are polymers that are produced by the living organisms. Nucleic acid and proteins are e...

Q: The myocardium would be the thickest in the ________.a. left atriumb. left ventriclec. right atriumd...

A: Blood vessels are the apparatus of the circulatory system that are required for transporting blood t...

Q: What are the structure of polynucleotide chain?

A: The nucleic acids are a long chain or polymer of repeating sub-units called nucleotides. Each nucleo...

Q: What is reproductiveisolation?

A: Genetics is the branch of biology that deals with the study of genes, their inheritance patterns, fa...

Q: As you learned, membranes impermeable to hydrogen ions are required for electron transfer phosphoryl...

A: Mitochondria produce energy by generation of hydrogen ions across a membrane.Mitochondria has two ho...

Q: What tissues of the plant provide the greatest opportunity to observe cells actively undergoing mito...

A: Mitosis can be defined as a process where a single cell divides into two identical daughter cells by...

Q: The doctors venosus connects the left portal vein to .............?

A:   Portal vein or HPV (hepatic portal vein) refers to the blood vessel that transports blood from the...

Q: Explain how loss-of-function mutations in the following categories of genes would affect the morphol...

A: Drosophila is also called fruit-fly. It is often used as a model for biological investigations.

Q: Examine the plant cell shown below, and answer the following questions about it. A. Does the liquid ...

A: Osmosis is the movement of water through a semi permeable membrane from a less concentrated solution...

Q: Differentiate between pure and hybrid strain.

A: Within a biological species, genetic variants are known to exist and these variants are known as str...

Q: What is the function of the kinetochore during mitosis?a. It promotes the attachment of monads to ea...

A: The term ‘cell division’ is defined as a series of phases, which the cell passes through to divide s...

Q: Outline the steps in DNase I footprinting, and analyze the results.

A: DNase I footprinting is assy that is used to identify the specific sites for DNA binding proteins.  ...

Q: Plant have ____ while animals lack it. A. starch B. cellulose C. protein D. fat

A: Plants differ from animals in many aspects, for example, plants are autotrophs while animals are het...

Q: Name four characteristics/properties of all living organisms.  For each describe how homo sapiens(hu...

A: The living organisms have come with certain characteristics that differentiate them from nonliving t...

Q: What is the powerhouse of the cell?

A: Powerhouse of the cell means it is related to energy producing cell organelle of the cell. So we nee...

Q: What are the types of cells of the Thyroid and hormones released by each one?

A: The thyroid gland is an endocrine gland in the neck consisting of two connected lobes. Thyroid hormo...

Q: Help

A: Scientific knowledge is what we learn from the scientific process, which involves experimenting and ...

Q: 10. Your instructor has given you three test tubes, each containing a different unknown solution. Af...

A: There are various types of biomolecules present in living organisms. Some are simple whereas others ...

Q: Identify the food sources of Listeria monocytogenesinfections. How does Listeria evade the immune sy...

A:   Listeria monocytogenes is a pathogenic bacteria that is capable of causing an infection known as l...

Q: Which muscle produces movement that allows you tocross your legs?a. the gluteus maximusb. the pirifo...

A: Movement is a change in posture or position of any body part of a living organism. It is essential a...

Q: Regions of the skin – Epidermis, dermis, subcutaneous layer, nails, hair, glands

A: The integumentary system is an organ system consisting of the skin, hair, nails, and exocrine glands...

Q: Bones are classified as long, short, flat, irregular, and seamoid (round). The bones of your digits ...

A: Bone is a dense connective tissue present in the human body which protects various organs, produce r...

Q: What is the acrosome?

A: A spermatozoon is motile sperm cells or moving from of the haploid cells that is the male gamete. A ...

Q: Based on the pedigree shown here for a trait determined by a single gene (affected individuals are s...

A: Introduction  Pedigree Analysis: this is the new approach to study the inheritance pattern in the fa...

Q: you had to dispore tissue and towels from dissection? you had to dicard dispoable microscope slide  ...

A: The dissection is the process of dismembering the body of a deceased animal or plant for studying th...

Q: What do glycogen and starch have in common?   how do they differ?

A: Glycogen and starch are polymers of glucose. In α-glucose, the hydroxyl group (-OH) at C1 (carbon 1)...

Q: Differentiate between diffusion and osmosis.

A: Plants lose huge amount of water through transpiration. Therefore, they have to replenish the lost w...

Q: Define glycolysis and explain its input and output, its basic steps, andhow it is linked to the Kreb...

A: Glycolysis, Krebs cycle, and Oxidative phosphorylation are three essential stages of cellular respir...

Q: Predict how lethal alleles may affect the outcome of a cross.

A: Genetics is a study of genes, heredity, and genetic variation in an organism. Living organisms inher...

Q: The brother of a woman's father has haemophilia. Her father was unaffected, but she worries that she...

A: Since you have posted a multiple questions, we solve the first question for you. To get the remainin...

Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If th...

A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A), cytos...

Q: According to the story, what was baby Ben's genotype? What genotype would ben have to reproduce with...

A: BB and Bb genotype indicates "brown eyes." bb genotype indicates "blue eyes."  Hence, brown eyes are...

Q: The intermolecular force that is most important in keeping the two layers of a lipid bilayer togethe...

A: The lipid bilayer is a biological membrane consisting of two layers of lipid molecules. Each lipid m...

Q: Is the blueness a recessive trait why and why not  What was Elizabeth smith only possible genotype ?...

A: In genetics, a gene consists of two alleles. One allele which masks the effect of other allele is kn...

Q: Defining features of life forms in cellular organisms of the body?

A: The cellular level of an organization comprises a well-defined organization. It includes the basic l...

Q: Compare exocrine and endocrine glands and give examples.

A: EXOCRINE GLANDS -  They are attached to our body directly that is with the help of ducts. Substanc...

Q: What are mutation breeding?

A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to mistake...

Q: How are the properties of cohension, surface tension, and adhension similar?

A: Adhesion:It is the ability of a substance to stick to another dissimilar  substance.It is the attrac...

Q: What are somatotrophs?

A: The pituitary gland or hypophysis is a pea-sized gland found at the base of the brain. It is enclose...

Q: What is the function of decomposition in the ecosystem?

A: An ecosystem is a large community of living organisms in a specific area in which the biotic and abi...

Q: Draw diagrams that explain five possible mechanisms for thedevelopment of autoimmunity.

A: Autoimmunity is the phenomenon in which antibodies or T cells react with auto-antigens. Autoimmunity...

Q: Explain the family tree of living organisms?

A: Phylogeny deals with the evolutionary history and relationship of an organism with respect to other ...

Q: incidence reflect the likehood of developing a disease among a group of participants free of the dis...

A: Incidence can be defined as occurrence of new case of disease or injury in a population over a speci...

Ecological adaptations

An ecological adaptation is any morphological, physiological, or behavioral trait of an organism that allows it to survive and reproduce in a habitat or ecosystem. Adaptation is a biological mechanism by which an organism gradually gets more acclimated to its surroundings.