Make a food web consisting of (rice, cooking oil, oyster sauce, green peas, Onion, Garlic, Egg

Q: How does oxygen and carbon dioxide enter and leave the lung capilliaries respectively? (Multiple…

A: The billions of alveoli in the lungs, as well as the capillaries which surround them, interchange…

Q: In photosystem II proton coupled electron transfer reactions are thought to be necessary after which…

A: *The enzyme photosystem II catalyzes light driven oxidation of water in oxygenic photosynthesis.…

Q: female calico cat has patches of black and white due to random x-chromosome inactivation a.…

A: * Calico cats are always femal and they will displays red and black based colors  depends on which…

Q: Comment on the accuracy of the aminoacylation during the charging of tRNA to ensure the fidelity of…

A: Amino acid activation or commonly known as tRNA charging, refers to the attachment of an amino acid…

Q: Write the correct letter before the number for the best description of the different reproductive…

A: Biological species concept defines organisms as being, or not being of the same of the same species…

Q: highly methylated DNA is active while less methylated DNA is inactive true or false

A: Statement is false.  DNA methylation is basically the attachment of a methyl group to a nucleotide…

Q: 13. A silent mutation A) does not change the protein that is produced. B) has a very minor change on…

A: In our existing nature, the mutation is very dynamic and it subjects to various types of heritable…

Q: enzymes ECORI and HINDIII are called "compatible" enzymes. DNA cut with these enzymes can be ligated…

A: Restriction Endonucleases Restriction endonucleases or restriction enzymes are the enzymes that can…

Q: Figure 1 Figure 2

A: DNA is known as the deoxyribonucleic acid. DNA has the chromosome which carries the genes and these…

Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…

A: RNA polymerase  extend or polymerise RNA.   Sigma subunit of RNA polymerase binds to promoter…

Q: A patient has reduced FEV1, and lower lung volumes overall.  What is your diagnosis?   the patient…

A: The quantity of air one can drive out of the lungs in one second is known as FEV1. Spirometry,…

Q: e the types of gametes the F1’s may be expected to form and the proportion of each. c. What are the…

A: Autotetraploidy is a genetic abnormality defined by the presence of four times the haploid number of…

Q: Label which parts of the cell cytoplasm, nucleus, ETC. were stained with Harris Hematoxylin, EA-50,…

A: Given information The cells are stained by: Harris hematoxylin stain  EA-50 OG-6

Q: 1. Methylation of DNA and acetylation of histones are inversely correlated. II. Methylation and…

A: The simplest physical as well functional component of heredity is the gene. DNA can be referred to…

Q: In the very first round of PCR using genomic DNA,the DNA primers prime synthesis that terminates…

A: It is a quick and versatile in vitro molecular biology technique for amplifying the defined target…

Q: What is the importance of surfactant in the lungs?   it reduces the surface tension of water in the…

A: Introduction Pulmonary surfactant (PS) is a protein and lipid mixture produced by alveolar type-II…

Q: Both cartilaginous and bony fishes have______ . a. jaws d. a swim bladder b. a bony skeleton e. a…

A: The term vertebrate is derived from the word vertebrae, which refers to the bones that make up the…

Q: the cytoplasmic membrane is universally similar across the three Domains of life. Discuss this…

A: The cell membrane (also known as the plasma membrane (PM) or cytoplasmic membrane) is a biological…

Q: The concept of endosymbiosis as applied to chloroplast and mitochondria found in eukaryotes: a) is…

A: Endosymbiosis is a kind of relationship in which one organism enters in an another organism. The…

Q: Which of the following is associated with intracellular nuclear receptors? O Transcription factors O…

A: Intracellular receptors are biomolecules that can be found in the cytosol as unbound and soluble…

Q: Fever is a sign of pathogen infection. Statement 2: Vasodilation is a type of immune response that…

A: The immune response is the action of the body generated on encountering a foreign particle called…

Q: When a Prokaryote or Eukaryotic cell is placed in an aqueous (water) solution containing K+ and Na+…

A: A cell membrane separates all cells from their surroundings. The cell membrane controls what enters…

Q: In both Prokaryotes and Eukaryotes, which of the following structures can cross cell membranes using…

A: Introduction Cell transports are the movement of a material through the cell membrane. The material…

Q: Compare satellites, viroids, prions, and defective interfering particles (DIPs).

A: Subviral agents include satellites, viroids, prions, and defective interfering particles (DIPS).…

Q: 1. Which of the following Pseudomonas aeruginosa virulence factors has a mechanism of action similar…

A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Q: In guine pigs, rough coat (R) is dominant to smooth coat (r). What is the expected percentage of…

A: ANSWER';- 50% Explain;- A heterozygous guinea pig (Rr) and homozygous passive guinea pig (RR) have a…

Q: 9. Some biologists contend that the term double fertilization is a misnomer and that the process…

A: Fertlizatiion is the process of the male gamete, sperm, fusing with the female gamete, the ovum,…

Q: heterozygous mice for the Sd gene are shown to have relatively shorter or lack a tail true or false

A: Sd / wildtype = heterozygous = short tail  Wild type/ wild type = homozygous = long tail  Sd/Sd…

Q: 7.How does oxygen and carbon dioxide enter and leave the lung capilliaries respectively? Read and…

A: During the process of respiration the entry and exit of oxygen and carbon dioxide is facilitated by…

Q: Target cells are: O Cells that send the signal O Cells that receive and respond to the signal Cells…

A: Introduction cell signaling or cell communication is the ability of a cell to receive, process, and…

Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…

A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…

Q: A dominant gene that codes for white hair is represented by the symbol W. If a parent with the…

A: The dominant trait is the one that first appears or is visibly seen in organism. Even if only one…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.

Q: In prokaryotes, after the ribosomes completes a synthesis, one would expect to find a) a new…

A: Prokaryotic organisms don't have well defined nucleus. The nucleoid is found in place of nucleus in…

Q: The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA…

A: The following is the DNA information received by gel electrophoresis:   In lanes 1 and 2, each…

Q: Enzyme B requires Zn2+ (Zinc ion) to be functional. Zn2+ is a Cofactor O Product O Coenzyme O…

A: Coenzymes are chemical molecules that are needed for enzymatic performance by numerous enzymes.…

Q: In humans, the genes for red-green color blindness (R = normal, r = color blind) and hemophilia A (H…

A: Given: In humans, The genes for red-green color blindness (R = normal, r = color blind) and…

Q: Which figure represent the lock and key model? Substrate Figure 1 Figure 1 Figure 2 Figure 3 Enzyme…

A: Introduction :  lock and key model denoted the enzyme substrate interaction . Each Enzyme has a…

Q: Understand how a cancer cell from a primary benign tumor is able to leave the primary benign tumor…

A: Cancer metastasis is the spread of cancer cells to tissues and organs beyond where the tumor…

Q: The figure below shows the recognition sequences and cleavage positions of three restriction…

A: Restriction enzymes are those that have a tendnecy to cut the strands of DNA straight. This leads to…

Q: What is the role of oysters as a sustainable food source? O Oysters filter 50 gallons of ocean water…

A: Oysters are one of the keystone species present in our ecosystem that has a greater impact on the…

Q: Contrast endotoxins with exotoxins.

A: Introduction :- Endotoxins are lipopolysaccharide-protein complexes that are produced when a cell…

Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…

A: Twins are two offspring produced by same mother in same pregnancy.  Twins can be identical and non…

Q: the glycolytic enzyme pyruvate kinase is activated by dephosphorylation and inactivated by…

A: Pyruvate kinase  It's an important glycolysis enzyme that helps converting PEP (phosphoenolpyruvate)…

Q: Write a detail note on "Management of PH in individuals in O2" ?

A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…

Q: The types of host species a particular virus can infect are referred to as its (a) assembly (b)…

A: Viruses are simple, noncellular infectious microorganisms with DNA or RNA surrounded by the coat…

Q: how does a light-colored exoskeleton make beetles better adapted to the environment?

A: Introduction Exoskeleton:- It is a rigid or articulated envelope that supports and protects the soft…

Q: what reaction activates the amino acids for attachment to the appropriate tRNA before being…

A: Translation is the process of synthesis of proteins from mRNA. It is completed in three steps -…

Q: How does the ras path trigger the initiation of a new branch off an existing actin filament –…

A: Actin (thin filament) and myosin are examples of contractile proteins (thick filament). Troponin…

Q: Gregor Mendel followed specific steps when breeding pea plants to determine the underlying cause and…

A: Mendel’s seminal work was accomplished using the garden pea, Pisum sativum, to study inheritance.…

Nutrient Growth Medium

It is a culture medium or nutrient broth for all kinds of microorganisms to grow properly and create their colony. This matrix provides support to increase the population of microbes through the method of cell proliferation. It is regarded as the food material for those organisms. It is a type of in vitro mechanism, in which the development of life is processed outside the host body. It can be solid, semi-solid, or liquid in nature. Different kinds of cells develop in different types of media.