The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage) is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline. The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giving the patterns shown below. What does each pattern say about the cloned DNA

The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage) is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline. The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giving the patterns shown below. What does each pattern say about the cloned DNA

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Similar questions

Please ASAP. Thank you. What is the mechanism of action for CRE recombinase in the CRE-loxP system?
Q5) Restriction enzymes look for a very particular KIND OF sequence. What is that called. Give me an example of one.
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?
2. You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on ampicillin plates con-taining X-gal and pick one blue colony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
1.Your goal is to design a strategy to create thisfinal pDHFR plasmid for fusion protein expressionfrom the materials available:You have an empty pET21a expression vector and another vectorthat contains the fusion protein nucleotide sequence (pBluescript + GST-DHFR-His). (#) indicatesbp location ofenzyme cut: a.EcoRIonly, HindIII only, NotIonly, EcoRI and HindIII, EcoRI and NotI, or HindIII and NotI? b.Briefly explain the rationale for your selection. Please connect your rationale to the need for compatible ends without any further manipulation and required directionality of the DHFR fusion protein coding sequence relative to the T7 promoter that will drive its expression. c.What is the final size(kb)of your desired pDHFR plasmid ligation product based onyour design? d. Complete the chart providedto indicate thesize of all fragments(in bp)resultingfrom complete digestion of each plasmid givenyour strategy, andthe fragment(in kb)from each you would isolate for ligation.Please mind…
#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?
Q6) Why are ‘sticky ends’ useful biotechnologically? Q7) Why is this enzyme called a restriction endonuclease? How is it different from an exonuclease?