Q: What is different about mitosis in the plant cell as compared to the animal cell? Give two…
A: Asexual reproduction in both plant and animal cells occurs by cell division called mitosis. Animal…
Q: Which of the following statements is true? O The contractile ring divides the nucleus in two. O The…
A: Cell division is the process by which a parent cell divides to form two or more daughter cells. It…
Q: Describe the process of mitosis
A: Cell division is division of parent cell . It is of two types :- A ) Mitosis B ) Meiosis
Q: Mitosis in animals is responsible for the formation of what type of cells? (select all the apply)*
A: Answer: MITOSIS = It is the process takes place in the various organisms , to produce two identical…
Q: Cytokinesis usually, but not always, follows mitosis. If a cell undergoes mitosis and not…
A: The process of cell division causes the cell to divide and form two identical halves. Cell division…
Q: Il taken from the mouth of a frog to an g, and it produces a few cell types. You n say that the…
A: Multipotent cells can develop into more than one cell type, but are more limited than pluripotent…
Q: Define mitosis and cytokinesis. What changes in cell structure would result if cytokinesis did not…
A: In cell biology, mitosis is a piece of the cell cycle in which reproduced chromosomes are isolated…
Q: Differentiate between mitosis in animal cell and plant cell.
A: Cell division is the process in which a parent cell divides into two or more daughter cells. There…
Q: Cancer is caused by the uncontrolled division of abnormal cells. Taxol is an anti-cancer drug that…
A: Taxol (paclitaxel) is a cancer medication that interferes with the growth and spread of cancer cells…
Q: . Identify the phases of mitosis depicted in Figure 3-7 by inserting the correct name in the blank…
A: Cell division is defined as the process by which cell multiply and involve nuclear as well as…
Q: What aspects of mitosis are different in plant cells than animal cells, and why?
A: answer : Plant and animal cells both undergo mitotic cell divisions. Their main difference is how…
Q: During mitosis for plant and animal cells what are the stages.
A: Cell division encompasses a series of events that take place in a cell leading to DNA replication…
Q: Chromatin Exists in _________ and ___________ Forms.
A: The base unit of biological matter is considered a cell. It constitutes many organelles in it,…
Q: Mitosis includes all of the following processes except for ______________. Telophase…
A: The cell cycle is the sequence of events that occurs in a cell that results in its division into new…
Q: Explain the Mitosis in Animal Cells ?
A: When two chromatids of a duplicated chromosome are bound together at a region of DNA, then it is…
Q: Which phase of mitosis is depicted in the drawing below?a. Prophaseb. Prometaphasec. Metaphased.…
A: The cell is the basic structural and functional unit of the body. It is responsible for various…
Q: At which phase are centrioles beginning to move apart in animal cells? A) Telophase B) Anaphase C)…
A: Centrioles are paired barrel-shaped organelles found in the cytoplasm of animal cells near the…
Q: What is the purpose of cells doing mitosis and cytokinesis?
A: As we know all living organisms are made of basic unit of structure and function called as cell.…
Q: Estimate the duration of each phase of mitosis, identify which of stage of mitosis is the longest.…
A: In terms of the time factor involved in mitotic division, there is currently very little information…
Q: Which of the following statements are true regarding mitosis in humans?
A: The correct option are 23 pairs of sister chromatids are separated two genetically identical…
Q: Hemocytes are stem cells which become plasma cells of the White Blood Cell System. These cells…
A: Immune system refers to ability of the body to fight against pathogens. Antibodies are also known as…
Q: Importance of bonds/bonding in organsims of mitosis. Could you give me a detailed paragraph
A: Mitosis is a process of nuclear division in eukaryotic cells that occurs when a parent cell divides…
Q: What types of human cells would have many lysosomes?
A: Lysosomes can be defined as one of the chief cell organelles that are involved in digestion and…
Q: MITOSIS: Why is each cell stage a prerequisite to the next?
A:
Q: Can a human red blood cells undergo a regulated cell division? How about ATP synthesis
A: The red blood cells are special blood cells whose main function is to carry oxygen and transport…
Q: The sedative phenobarbital is a lipid-soluble drug. What may happen to the smooth ER in liver cells…
A: Phenobarbital drug is used in the treatment of epilepsy, seizures disease. Phenobarbital is effect…
Q: Distinguish between mitosis (karyokinesis) and cytoplasmic division (cytokinesis).
A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…
Q: es mitosis become detrimental or fatal to human? Cite a concrete example.
A: The process usually consists of the phenomenon in which a parent cell divides into two or more…
Q: The process of mitosis (select all that apply)
A: Mitosis is a nuclear division mechanism that occurs in eukaryotic cells when a parent cell divides…
Q: Why is mitosis so important? Give examples of 3 body processes that would require you to do mitosis.
A: Introduction Mitosis is a stage of the cell cycle in which replicated chromosomes are split into two…
Q: diagram shows a Wo distinct cellular structures that helped you make this determination ()?
A: It is a specialized cell.
Q: Thich of the following biological phenomena could you study using the model organism E.coli? O…
A: E. coli is a Gram-negative, facultatively anaerobic, rod-shaped, coliform bacterium. It belongs to…
Q: The unified cell theory proposed in the 1830's states that ?
A: Botanist Matthias Scleiden and zoologist Theodor Schwann proposed Unified cell theory. Cell theory…
Q: Explain how the medals law derives from the events that take place during mitosis.
A: Mendels law tells about the segregation of the two allels present in the same plant. His experiment…
Q: What is mitosis? Give a brief account of mitosis in animal cell?
A: Mitosis is a type of cell division in which the number of chromosomes in both the parent and progeny…
Q: Stages of Mitosis Draw and label all stages. Indicate the magnification.
A: A cell splits into two or maybe more new cells during the mechanism of cell division. Normally, cell…
Q: What would the result be if a cell underwent mitosis, but not cytokinesis
A: Mitosis is a mode of cell division in which one cell divides to form two cells.
Q: Cancer is a disease related to uncontrolled cell division. Investigate two known causes for these…
A: Cancer develops when the body's normal control mechanism stops working. Old cells do not die and…
Q: What would happen to a cell if the mitochondria cristae were damaged? should be an original thought,…
A: Cell organelles are the building blocks of a cell. They are useful for conducting various cell…
Q: animal cells
A: Human Cheek Cell The vacuole in an an animal cell is smaller in size, or absent. The nucleus is…
Q: Animal cell division is signified by the formation of cleavage furrow as oppose to plant cells, this…
A: Cell division is the process where a parent cell undergoes division to form two (mitosis) or more…
Q: Which stage of mitosis in an animal cell does each part of Figure Q6 represent? (A) (B) (C) Figure…
A: Mitosis is a type of cell division in which daughter cells produced are genetically identical to…
Q: For smooth ER which macromolecule(s) ( carbohydrate, proteins, lipids, and Nucleic acids) contribute…
A: Endoplasmic reticulum is a continuous membrane system that forms a series of flattened sacs within…
Q: Virtually every multicellular organism, including you, goes from a single-cell fertilized egg to a…
A: Sexual reproduction in higher organisms is the combining and mixing of chromosomes during the…
Q: Cell differentiation in most animals results in
A: Cell differentiation causes differences in the structure and function of all the cells in an…
Q: Mitosis is a form Of ____. There are three other ways in which these two processes differ
A: The procedure whereby a parent cell divides into two or more daughter cells is known as cell…
Q: You already know that ribosomes are abundant in redblood cells. In what other cells of the body…
A: The ribosome is a complex molecule composed of ribosomal RNA molecules and proteins that functions…
Q: True or False. Plant cells contain many of the same organelles as animal cells, with the addition…
A: Cell is the basic structural and functional unit of life. The cells structure and shape are…
Q: etermine what happens as if the spindle fiber failed to form in a cell during the process of mit
A: Spindle fibres are the proteins that give chromosomes structure and organisation by serving as an…
Q: List the two functions( purposes) of mitosis in humans
A: We’ll answer the first question since the exact one wasn’t specified. Please re-submit a new…
Step by step
Solved in 2 steps
- What type of DNA changes are revealed from p.Gln39X mutation. Is it pathogenic?eleven The gene known to be mutated in cases of Agammaglobulinemia 2 (which is inherited in an autosomal recessive pattern) is the immunoglobulin lambda like polypeptide 1 (IGLL1 ENSG00000128322). What is known about the gene is recorded here: http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000128322;r=22:23573125-23580302 Please navigate to the link above to answer the following question: According to the web site above, how many phenotypes is IGLL1 associated with?Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myeloid leukaemia Select one: A.t(8;21) translocation (RUNX1‐RUNXT1 fusion) B.DNMT3A mutation C.TP53 deletion D.NPM1 (nucleophosmin) mutation
- An ade+ arg+ cys+ his+ leu+ pro+ bacterial strain is knownto be lysogenic for a newly discovered phage, but the siteof the prophage is not known. The bacterial map isleucysarghisadeproThe lysogenic strain is used as a source of the phage, andthe phages are added to a bacterial strain of genotypeade- arg- cys- his- leu- pro-. After a short incubation,samples of these bacteria are plated on six differentmedia, with the supplementations indicated in thefollowing table. The table also shows whether colonieswere observed on the various media.PresenceMedium Ade Arg Cys His Leu Pro of colonies1 - + + + + + N2 + - + + + + N3 + + - + + + C4 + + + - + + N5 + + + + - + C6 + + + + + - NNutrient supplementation in medium(In this table, a plus sign indicates the presence of anutrient supplement, a minus sign indicates that asupplement is not present, N indicates no colonies, and Cindicates colonies present.)a. What genetic process is at work here?b. What is the approximate locus of the prophage?Hello! Discuss the oncosuppresive function of xenophagy. -is it oncosuppresive? How can it be oncogenic? -How does it promote cancer? -Can xenophagy tag bacteria for lysosomal degradation?(ubiquitin and galactin-8). Thank you!Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A. mucopolysaccharidosis type II B. Turcot syndrome C. Haemophilia A D. Xeroderma pigmentosum E. Haemophilia B F. Ataxia Telangiectasia G. Noonan syndrome H. Li-fraumeni syndrome I. Hunter syndrome J. Ocular motor apraxia
- Infection with SARS-CoV-2 can result in a wide range, and severity, of symptoms. Researchsuggests that some of this variation arises from the genetic variations between humans. Forexample, individuals with mutations in their interferon genes have a more severe response toSARS-CoV-2. Describe two general types of mutations that may occur in DNA, and how thesemutations might affect production of interferon-gamma. (Please note that I am looking for generaltypes of mutations, not specific nucleotide changes.)Which ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the most favourable prognosis? Select one: A.Deletion of chromosome 5 B.Normal karyotype with FLT3 tyrosine kinase domain mutation C.t(8;21) translocation D.Deletion of chromosome 7can you please help me out with this ? Mutations in the IL2RG gene cause approximately 30 percent of severe combined immunodeficiency disorder (SCID) cases in humans. These mutations result in alterations to a protein component of cytokine receptors that are essential for proper development of the immune system. The IL2RG gene is composed of eight exons and contains upstream and downstream sequences that are necessary for proper transcription and translation. Below are some of the mutations observed. For each, explain its likely influence on the IL2RG gene product (assume its length to be 375 amino acids). Nonsense mutation in a coding region Insertion in Exon 1, causing frameshift Insertion in Exon 7, causing frameshift Missense mutation Deletion in Exon 2, causing frameshift Deletion in Exon 2, in frame (g) Large deletion covering Exons 2 and 3
- MM, a 54-year old female presents to the Family Medicine Clinic due to a 2-week history of increasing shortness of breath and cough and mild/moderate pain in left side. She was diagnosed with infiltrating intraductal adenocarcinoma of the left breast 5 years ago; at that time, ER(-)/ PR(-); her-2/neu(+); p53(+); staged as having T3N1M0, stage IIIA, high-risk breast cancer. She underwent a modified radical mastectomy with axillary node dissection followed by 6 cycles of CMF chemotherapy. Her mother and sister also had a history of breast cancer. Past Medical History Gravida 4, para 4; menses onset age 13; HTN x 10 years; Type 2 DM x 8 years; breast CA described above; remained disease free until present follow up. Past Surgical History: Left modified radical mastectomy 5 years ago; cholecystectomy 14 years ago. Medications: Glyburide, 5mg PO BID Verapamil SR, 240mg PO daily Furosemide, 40mg PO daily Allergies: NKDA Physical Examination: GEN: Well-developed, obese woman in no…13. A 40-year old woman who has an operation and adjuvant chemotherapy fpr colon cancer is being monitored every 6 months. AT the latest visit, a blood test shows that she may have a recurrence of the cancer. The laboratory finding most liekly to indicate this recurrence is an increased serum concentration of whichof the following (A) CA-125 (B) CD-10(CALLA) (C) Carcinoembryonic antigen (D) alpha Fetoprotein (E) Human Chorionic GonadotropinProto-oncogenes can be converted to oncogenes in a numberof different ways. In some cases, the proto-oncogene itselfbecomes amplified up to hundreds of times in a cancer cell.An example is the cyclin D1 gene, which is amplified in somecancers. In other cases, the proto-oncogene may be mutatedin a limited number of specific ways, leading to alterations inthe gene product’s structure. The ras gene is an example of aproto-oncogene that becomes oncogenic after suffering pointmutations in specific regions of the gene. Explain why thesetwo proto-oncogenes (cyclin D1 and ras) undergo such differentalterations to convert them into oncogenes