Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A. mucopolysaccharidosis type II B. Turcot syndrome C. Haemophilia A D. Xeroderma pigmentosum E. Haemophilia B F. Ataxia Telangiectasia G. Noonan syndrome H. Li-fraumeni syndrome I. Hunter syndrome J. Ocular motor apraxia

Q: Buffers in pharmaceutical and biological systems

A: The pH of a solution refers to the concentration of H+ ions in a solution. If the H+ concentration…

Q: Q2. Circle true or false for each stat ni bavlovni smyno sto siqmsxs n6 zi sbimsoqu 1) T F Oxygen…

A: Since you have posted multiple questions, we will provide the solution only to the first five…

Q: One xylulose 5-phosphate, One glyceraldehyde 3-phosphate, One sedoheptulose 7-phosphate, 1…

A: After glucose enters the cell it is immediately phosphorylated into glucose 6-phosphate. Glucose…

Q: As a result of complete fasting for 3 days, a significant change in metabolism occurs. How will the…

A: Cells are machinery structures which carry out various complex controlled biochemical reactions in…

Q: what are the features which set the G protein family of receptors apart?

A: G protein-coupled receptors (GPCRs) are regarded as one of the most extensive families of validated…

Q: 3. Prostaglandins (5) are derived from the 20-carbon fatty acid arachidonic acid in a reaction…

A: In order to solve this problem , we need to draw the Lineweaver Burk plot (LB plot). LB plot has…

Q: E (A) ernisto q (B) muhdiliups noitsioozzib 293izonuod to noitent norw My 0.8 21 (C)sgil 9911 to ne…

A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…

Q: If the AH for a reaction is -4 kJ/mol and the AS is 20 J/(molK), which of the following statements…

A: Standard free energy of a reaction is calculated in order to quantify the spontaneity of a reaction…

Q: NADH is generated at which of the following enzyme site(s) in the citric acid cycle? OA) Aconitase.…

A: Citric acid cycle is the second step in aerobic cellular respiration. This stage results in the…

Q: Bond Type: Description: ОН CH2OH ОН ОН ОН Н ОН От CH₂OH ОН Н OH-0 ОН Н ОН :CI: Nat :ci: Nat Na :CI:…

A: Chemical bonds are formed between the same or different atoms to give rise to chemical compounds.…

Q: Metabolic enzymes are often found in large multi-enzyme complexes. What are the benefits of this…

A: Enzymes are biological catalysts that catalyse biochemical reactions. Substrates bind to the free…

Q: Response elements are similar to operons in that they are controlled by a single promoter are…

A: The transcription of genes is controlled by response elements, which are brief DNA sequences found…

Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the…

A: The proteins are constituted of twenty naturally occurring amino acids. Each amino acid is encoded…

Q: Glyoxylate cycle allows the conversion of __ to __ in __  A. Glucose ;lipids ;plants  B. Lipids;…

A: The primary source of energy for living cells is carbohydrates. The key molecule in the metabolism…

Q: 18. A biochemist has a 0.1000 L sample of a globin protein at a concentration of 0.0500 M. The P50…

A: Recall that: Fractional Saturation (θ) is the fraction of protein molecules saturated with a ligand.…

Q: In the folded protein, His108 forms a salt bridge with Asp44. The pKa of the imidazole functional…

A: pKa is the pH at which a weak acid is 50% dissociated into H+ and conjugate base. Also, pKa = -log…

Q: 1 Draw a general sketch ( backbone only ) of a protein alpha- helix and a beta shet.

A: Hi, thank you for the question. As per the honor code, we'll answer the first question since the…

Q: During the metabolism of glucose in anaerobic cells, the enzyme lactate dehydrogenase is essential…

A: Lactate dehydrogenase catalyzes the interconversion of pyruvate and lactate. The enzyme is an…

Q: Circle the functional groups on the R-group of the AMINO ACIDS below that are capable of forming…

A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…

Q: 9. Compartmentation in ß Oxidation Free palmitate is activated to its coenzyme A derivative…

A: Beta oxidation is the biochemical pathway by which fatty acids are broken down two carbon at a time…

Q: Sugar Molisch's Solution Test Glucose Sucrose Lactose Hydrolysis: Samples Sucrose hydrolysate Starch…

A: Qualitative tests are used to determine for the presence or absence of any substance in the given…

Q: Draw the synthesis of the dinucleotide formed between ATP and GMP. The 5' triphosphate can be…

A: Guanosine Monophosphate kinase catalyze the phosphate transfer reaction in which the terminal gamma…

Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ Determine the…

A: Genes are functional segments of DNA that code for particular proteins. Each gene has its unique…

Q: Select lipid samples under triacylglycerol (one simple and one mixed), phospholipid, and…

A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…

Q: why are fast acting neurotransmitters typically are small molecules?

A: Neurotransmitter is a signaling molecule secreted by neurons to affect another cell across a…

Q: I. ATP Calculation A. Given that three molecules of glucose underwent full oxidation, how many of…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…

Q: Subunit Composition of a Protein. A protein has a molecular mass of 400 kDa when measured by…

A: Size exclusion chromatography is a technique which separates molecules according to their size…

Q: Nadph is primarily produced in the ___ through the ___ process. it is consumed during ___ a.…

A: After glucose enters a cell, it is immediately converted to glucose 6-phosphate. Glucose 6 phosphate…

Q: what is the net reaction of the citric acid cycle for a single acetyl coenzyme A molecule? what are…

A: TCA cycle is also called as Krebs cycle a cyclic process that converts Pyruvate to CO2. It is a…

Q: What charge at pencentage of the Histidane side chain will PH = 7₁4? Cerrry No.

A: His is basic polar amino acids and His contains imidazole as side chain group. pKa of His is 6. pH…

Q: argarines made from plants oils are healthier ,since they are hydrogenated. A) TRUE B)FALSE

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…

Q: A student wanted to load .75 ug dna on agarose gel and has 4x loading buffer for sample preparation.…

A: Agarose gel electrophoresis is a method used for the separation of DNA fragments which is stained by…

Q: Responses elicited by cAMP production EXCEPT     glycogen breakdown     increased secretion of…

A: G-protein is a GTP binding protein that is found closely associated with the receptor called…

Q: Choose below the order of plasma lipoproteins based on the particle size (from smallest to largest):…

A: Lipoproteins are particles made of protein and lipids. They are responsible for carrying cholesterol…

Q: Discuss the cellular location and biological significance of the processes of the citric acid cycle…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…

Q: Reabsorption of this substance involves carbonic anhydrase - inulin - bicarbonate - glucose -…

A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…

Q: The diffusion rate of four different membrane proteins (A, B, C, and D) was measured using a FRAP…

A: FRAP is short for Fluorescence recovery after photobleaching, is a method used for determining the…

Q: *Determine the ATP yield from the metabolism of one molecule of glucose under the following…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…

Q: Hd 12 10 8 6 4 2 0 not text. 0.5 only, no text. only, no text. 1 1.5 NaOH Equivalents 2 You create…

A: Amino acids are biomolecules k that have an amino group, a carboxyl group and a side group linked to…

Q: compare that hypothetical mechanism to the classical presentation described in our textbook. What…

A: ETC  is an arrangement of protein complexes and some non-protein components in an increasing redox…

Q: What is acrolein test? explain in 5 sentences essay

A: Triglycerides or triacylglycerides or simple fats are fatty acid esters of glycerols. In…

Q: State the function and desired products of the hexose monophosphate shunt pathway.

A: Cells metabolize glucose molecules through the glycolytic pathway to release the energy required for…

Q: How many mL of 10 x stock solution would you need to make 118 mL of 1x PBS?  Report your answer to 1…

A: The equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock solution. C2…

Q: Give other chromatographic techniques that can be used for separating non-polar biomolecules, such…

A: Introduction: Chromatography is a method for separating a mixture in the laboratory. The mixture is…

Q: 4. Write the equation for the digestion (hydrolysis) of Phe-Asp-Ala.

A: A tripeptide is made up of three amino acid residues linked via a peptide bond. A peptide bond is…

Q: This assay is the most common method of detection in enzyme assays: A. рН B. spectrophotometric…

A: Enzymes are the biological catalysts that can convert substrate molecules to products. Enzyme assays…

Q: In the synthesis of urea, one nitrogen atom comes from ammonia, the other comes from: ○ A) fumarate.…

A: The urea cycle (or ornithine cycle) is a cycle of biochemical reactions that produces urea from…

Q: ~0.766+ 47425 y-0.568x46576 . . . . . X The inhibitor binds at the active site. The inhibitor binds…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: ）picture1: what bond is this between cytosine and ribose？ 2）picture2 ： what bond is that bewteen…

A: Nucleotides are compounds made up of a nitrogen base, a sugar and a phosphate. The base can be…

Q: How much 4x loading dye should be added to 11 uL of DNA?  Report you answer in units of uL, with one…

A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…

Tissue regeneration & repair

Tissue regeneration involves the restoration of tissue components by regrowth of damaged tissues. In contrast, tissue repair involves patching of injured tissue rather than restoring it. It is the proliferative capacity of the cells that decides the amount of regeneration against the repair that would occur in the tissue. Both regeneration and repair depending on the duration of the injury and response to the inflammation.