Q: What is outgroup analysis?
A: An outgroup is a collection of creatures that acts as a benchmark for determining the ingroup's…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: Describe the steps of transcription in bacteria
A: Introduction - In the nucleus, transcription occurs. To make an RNA (mRNA) molecule, it uses DNA as…
Q: energy flow differently in island pyramids vs landscape pyramids? Is the recycling of matter more…
A: The pyramid of energy depicts the flow of energy from one trophic level to another trophic level. It…
Q: Which factor is not required for natural selection to occur?
A: This question is based on evolution and natural selection.
Q: . Which of the following is mismatched? a) Increased UVC radiation — CFCs b) Acid rain — nuclear…
A: Introduction Fully or partially halogenated hydrocarbons containing carbon, hydrogen, chlorine, and…
Q: The following graph shows the trends in bacteria and viruses after they infect an organism. Part…
A: Introduction Bacteria are minute, single-celled organisms that can be found in large numbers in all…
Q: Is a trisomic an aneuploid or a polyploid?
A: Trisomy is a genetic condition in which an extra chromosome or part of a chromosome is added to a…
Q: Identify the stages of mitotic division observed in one of SimpLENI's slides labeled as A, B, and C.…
A: The stage labeled as A is Telophase. Telophase is the 4th stage of mitosis where the sister…
Q: Describe the difference between the nerve and muscle in response to increasing stimulus voltage.
A: Introduction A nerve is a cable-like structure within the body composed of neurons that uses…
Q: Match the organs with their functions pancreas a. production of saliva b. secretes pancreatic juice…
A: The Digestive System: The digestive system breaks down the food into smaller pieces so that it can…
Q: If you had a mixture of single-stranded DNA fragments, all 4 deoxyribonucleoside triphosphates, and…
A: DNA replication is the process of producing complementary DNA molecules from the ds DNA molecule.
Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…
A: * Okazaki fragment are short sequences of DNA nucleotides. * They are of approximately 150 to 200…
Q: What is pecten and what is thought to be its function? 2. Please describe the typical hunting…
A: Note- As per Bartleby rules, we are supposed to answer only first three questions. Kindly repost The…
Q: The subunit in E. coli RNA polymerase which is required for recognition of the promoter sequence is…
A: Transcription is a process by which an RNA copy of the DNA is made. It is an important step in gene…
Q: Channels for sodium ions in the cell membrane open and sodium flows into the cell Both channels for…
A: Action potential are basically nerve signals which results in sudden change in the resting membrane…
Q: For genotype: repP¯ lacP lacP* lacO* lacZ* lacY Select the best description of permease activity in…
A: A) Permease activity:- Lactose Present; Glucose Present-- 4.lower than basal. Lactose Present:…
Q: HITCHHIKER'S THUMB: The distal (last) joint of the thumb can be bent back to form a 45 degree angle…
A: Hitchhiker thumb is encoded by gene present on autosomal chromosome. It is a recessive trait.
Q: Which of the following helps Human sperm with locomotion? a) Flagellum b) Basal body c) Nucleosome…
A: *Sperm is male reproductive gamete that produce motile sperm with a tail called as flagellum…
Q: 1_Vancomycin inhibits cell wall synthesis by: a.Binding irreversibly to transpeptidase and inhibit…
A: Vancomycin inhibits cell wall synthesis in gram-positive bacteria by binding firmly to the…
Q: Which of the following is the most accurate statement regarding the problem with using life…
A: Option 3 Life expectancy give you average of country but significant differences within groups of…
Q: First find and label ATP Synthase on the diagram below. Make boxes and add the labels for ATP, ADP,…
A: Cellular respiration takes place in four steps glycolysis where glucose is converted into pyruvate.…
Q: The principal DNA polymerase in eukaryotic leading strand DNA replication is: A DNA polymerase B…
A: * DNA polymerase catalyze the synthesis of DNA molecules from precursors of DNA which are essential…
Q: The eukaryotic transcription factor that exhibits a sequence specificity for the TATA box is: A)…
A: Transcription is the first step in the gene expression which transfers the genetic information…
Q: Your uncle has tried every diet under the sun, yet he is still a very large man. He probably has…
A: When a person eats excess food and is not put into use then this food turns into fat reserve which…
Q: Having the ability to degrade the DNA allows the DNA polymerase to perform its job properly and…
A: Answer :- True. - It is true that having the ability to degrade the DNA allows the DNA polymerase to…
Q: 12. Below is a diagram of a cell. Which of the following is true? a. The cell is a plant cell,…
A:
Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…
A: NFKB is a transcription regulator that is activated by cytokines, oxidant-free radicals, ultraviolet…
Q: The normal sequence of nine genes on a certainDrosophila chromosome is 123 • 456789, where the…
A: The basic karyotype of Drosophila melanogaster, which is observed mitotically comprises active…
Q: Vitamin A deficiency and blindness are a major problem in 3rd world countries. A program called…
A: Vitamin A is a nutrient that is important for the body for growth, vision, cell division, immunity…
Q: Acetylcholine is necessary for the depolarization of skeletal muscle cells. Which of the following…
A: * Acetylcholine is an chemical that functions in brain and body as neurotransmitter. *It is an…
Q: iscuss the intestinal phase of gastric secretion regulation with examples
A: The digestive system is involved in a variety of processes, including food digestion and nutrient…
Q: After a naive B cell encounters a 1 and binds an antigen with its2 it enguifs and degrades the…
A: Immune cells are of two types: B -cells and T-cells. The B-cells which has never encounter any…
Q: Q.2. State the behavioural changes observed in an alcohol addict and remedial measures to overcome…
A: The following modifications have been observed: Because alcoholic beverages are expensive, they…
Q: An example of a limiting factor would be the amount of food available in a population. True False
A: Introduction :- A limiting factor is something that restricts the size of a population and slows or…
Q: Identify one technology which would cause a significant reduction in the primary pollutants…
A: Introduction - Pollution from automobiles, power stations, industrial boilers, refineries, and…
Q: DIRECTIONS: Examine the illustrations of the marine organisms shown below whose fossils make up part…
A: * Darwin said that the Fossils records provide evidence that the living organisms evolved from many…
Q: Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives.…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: 10. Modified true or false: Write T if the statement is true; if false, write F, underline the word…
A: Plants are classified as flowering plants and non-flowering plants. Flowering plants are divided…
Q: Question 48 The energetic driving force for the synthesis of the new strand is the removal of the…
A: Removal of pyrophosphate group yields energy which is then diverted to the formation of new strands…
Q: Please could you explain how lymphocytes (especially B) can maintain receptors on their surfaces? Is…
A: Introduction A lymphocyte is a type of white blood cell found in most vertebrates' immune systems.…
Q: Organisms that produce offspring that always look like the parents are said to be: O Purebred/Pure…
A: Organisms that produce offsprings that always look like the parents are said to be.
Q: 7. In the PCR technique, each round of amplification by the Taq DNA Polymerase enzyme produces 2 new…
A: Introduction PCR is a technique that helps to amplify specific DNA sequences. The strands of DNA…
Q: List The Functions of Polysaccharides.
A: Carbohydrates are a significant wellspring of food and a significant type of energy for most living…
Q: Why do acentric fragments get lost?
A: Introduction :- A chromosomal segment with no centromere is known as an acentric fragment.Acentric…
Q: which germ layer (tissue) gives rice to our nervous system and outer coverings. a) endotherm b)…
A: The mesoderm, or middle tissue, gives rise to most of the muscle and connective tissues. Finally the…
Q: Cuvier's idea of catastrophe related to asteroid collisions understanding that geological change…
A: Theory of catastrophes by George's Cuvier According to this theory, fossil show that animal and…
Q: Compare the prevalence of neglected tropical diseases to the much better known and deadlier…
A: * Non Tropical Diseases can be found in countries like Africa and Asia, and Latin America and…
Q: Who is Wisdom and what record does she hold? 2. What are salt glands and why do seabirds have them?…
A: 1. I couldn't understand it properly. Probably this will help you... Wisdom is a literary…
Q: An enzyme that acts as both a kinase and phosphatase in rxn. of 1 uM 1,3-bisphosphoglycerate,…
A: An enzyme that adds phosphate groups (PO43) to other molecules is known as kinase. Kinases are…
Step by step
Solved in 2 steps with 2 images