apply the basic principles underlying the structure of the cell membrane and proteins to understand the nature of electrical excitability in cells? NeuronsDendritesSignalling DirectionAxon(Diameter 1-20μm Length 1mm-20mCell BodyTerminal Branchesof Axon

Electrical signals regulate the contraction of muscle, secretion of hormones, sensation of the…

Answered: Neurons Dendrites Signalling Direction…

Science

Biology

Neurons Dendrites Signalling Direction Axon (Diameter 1-20m Length 1mm-20m Cell Body Terminal Branches of Axon

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter35: The Nervous System

Section: Chapter Questions

Problem 5RQ: A(n)______neuron has one axon and one____ dendrite extending directly from the cell body. unipolar...

See similar textbooks

Related questions

Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…

A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…

Q: 2. Describe and draw a representative example of the following arrangements of cells: a. diplococci…

A: This refers to shape and structure of bacteria. Some bacteria are Spherical or rod shaped. Out of…

Q: A proteinase found in the lysosome functions by ____. Select one: a. making proteins b. assisting…

A: Lysosomal proteases or proteinase are hydrolytic enzymes that belong to the aspartic, cysteine, or…

Q: Capacitation involves the a. inhibition of sperm maturation and activation of acrisomal…

A: Capacitation occurs in female reproductive tract. It involves biochemical changes which helps the…

Q: Investigators interested in understanding the relationship between mammography and breast…

A: Research design is a way of planning that instructs how the research will be going to conduct. Based…

Q: 1. A man has the genotype BbEE. He has brown hair and free earlobes. This man met a woman with the…

A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…

Q: Actin (which makes up the cytoskeleton) is an example of a/an ______. Hemoglobin is an example of a…

A: All eukaryotic cells contain the highly abundant intracellular protein actin, which is essential for…

Q: What are the variables of Fried's Scale?

A: "Physical fitness is essential in our everyday lives, it benefits us in so many ways and makes us…

Q: could you please draw this on an A4 paper using dots for the shading

A: This is probably a microorganism in a cullture media. The image can we clearly viewed under a…

Q: Investigators enrolled 40 diabetics without eye disease in a cohort (follow-up) study. The results…

A: After 1 year, number of persons who developed disease = 0 out of 32 At the end of 2 years, number of…

Q: What structure does the proximal tubule lead to? O O intermediate tubule O glomerulus O distal…

A: In vertebrates,Kidneys are the main oragn which involved in excretion.In each kidney,there is…

Q: 4. A bacterium is suddenly expelled from a warm human intestine into the cold world outside (hey,…

A: The characteristic of the cell membrane known as cell membrane fluidity enables it to change its…

Q: Slow block to polyspermy is linked to the cytosolic accumulation of the ion _____ a. hydrogen…

A: The fusing of the cortical vesicles and plasma membrane creates a slower, more long-lasting barrier…

Q: Ch. 5: Which of the following is FALSE regarding Acute Respiratory Distress Syndrome (ARDS)? a) it…

A: Macrophages, in addition to leukocytes and endothelial cells, are crucial for the inflammatory…

Q: O a base substitution in an intron 5' splice site O a frameshift in an exon O a missense in an exon…

A: The answer to the question is A frameshift in exon

Q: some examples in yourlife about microorganisms.

A: The term "Microorganisms" can be broken down into two words "micro" which means very small that can…

Q: DNA has the O thymine; uracil nucleotide, whereas RNA has the thymine; adenine O adenine; cytosine O…

A: INTRODUCTION DNA : Deoxyribonuleic acid RNA : Ribonucleic acid

Q: You and your team continue to study the population of long-tongued pucas. You counted 1,000…

A: We use the following formula to calculate a population's overall per capita growth rate over a…

Q: 14. Which of the amino acids below donates an ammonia group to every molecule of urea? a. Serine b.…

A: We all know that there is a continuous urea cycle occuring in our body.Some amino acids are also…

Q: Why are SNPs beneficial over SSRs for getting a more precise location of a gene of interest? Select…

A: Studies demonstrate that SSRs are the marker of choice for parentage and assignment investigations…

Q: During sarcomere contraction, _________ first has to bind to ________ Select one: a. Calcium,…

A: Because of their structure, sarcomeres in the skeletal muscles begin this movement through…

Q: Which of the following are associated with the autonomic nervous system? L O both parasympathetic…

A: The peripheral nervous system's autonomic nervous system controls physiological functions that are…

Q: describe the mechanism in which roots can express positive geo-tropism

A: The root cap is said to experience the effects of gravity. In the event that the plant's roots had…

Q: Short Answer 3. The pedigree shown is of a family with an X-linked recessive disease. The sex…

A: A. Nondisjunction can happen during the anaphase of mitosis, meiosis I, or meiosis II. Sister…

Q: Organisms can use a variety of carbon and energy sources, depending on their availability in the…

A: Metabolic processes are the processes takes place inside the living organisms in which larger…

Q: Which of the following statements regarding transduction is FALSE? A) transduction reduces genetic…

A: A virus moves its genetic information from one bacterium to another through a process called…

Q: Ch. 6: Signs and symptoms of hyponatremia would include: a) headache, rapid breathing, high…

A: ANSWER) Hyponatremia is described as the state of low sodium levels in the body which are mainly due…

Q: cell? What has to happen to it? 2. Do mutations that cause cancer in an individual pass down to the…

A: Cancer occurs when the cell divides uncontrollably to form a lump called tumor. It may occur due to…

Q: cystolic protein that was incorrectly sent to the Golgi Apparatus. Select one: a. there was an error…

A: Introduction and explanation - Also known as Golgi complex, Golgi body or Golgi.• Membrane bound…

Q: Apart from lactate oxidation within the skeletal muscle, what is the name of the other system…

A: Skeletal muscle is one of the significant muscle tissues present in the human body. Each skeletal…

Q: Black Plague is caused by a..... protozoan (protist) Obacterial Oprion O fungus O virus

A: What is plague? A plague is an infectious disease, which is caused by the bacteria Yersinia pestis.…

Q: Nonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient…

A: Tay Sachs is an autosomal recessive genetic disorder caused by the buildup of harmful amounts of a…

Q: Which of the following bio molecules can form beta sheets select all that apply rna lipids…

A: Extended amphipathic sheets are created when many strands self-assemble and are maintained by…

Q: Which of the following is placed in the correct order of smallest to largest? Selected answer will…

A: Introduction metre (m), also called meter, in measurement of length, width , depth distance etc.…

Q: Table 1. Average turgor loss point, stem hydraulic conductivity and plant water use efficiency for…

A: The leaf of the plant is mostly rigid due to the turgor pressure exerted by the fluid of the plant…

Q: T-cell receptor diversity is controlled by __________. Select one: a. DNA recombination during…

A: More junctional areas and more N nucleotide addition are responsible for the enhanced T-cell…

Q: Ylear (MPa) 0 -2 -6 -8 Apr-07 Nov-07 Mar-14 Mar-15 Aug-15 Feb-16 וויווי --

A: Species A depicts shallow root which is dependent on soil moisture to get water for the plant while…

Q: Which of the following summarizes the role of calcium in muscle contraction? opens the binding sites…

A: The actin's active-binding sites are made visible by calcium ions attaching to the protein complex…

Q: Consider the following reaction: succinate +NAD is catalyzed into fumarate + NADH In this reaction,…

A: Several biochemical pathways are involved on maintaining proper physiological balance in the body.…

Q: Ch. 6: Respiratory alkalosis can develop from: a) hyperventilation b) prolonged use of antacids c)…

A: Respiratory system is a type of body system which is involved in removal of carbon dioxide and entry…

Q: 2. Energy flow is a central theme throughout the study of environmental science. Consider energy…

A: Biomes: Biomes are significant because they are vast geographical units typified by a certain kind…

Q: can you answer in 5 simple statement please

A: Robert Koch in the 1890s gave 4 postulates to identify whether a specific microorganism is…

Q: oxidized

A: e .tertiary ,oxidized The formation of disulfide bridges by oxidation of the sulfydryl groups on…

Q: Name the cells in the islets of langerhans which make glucagon and summarize the principles and…

A: The generation and release of hormones that control blood glucose levels is carried out by a group…

Q: Ch. 7: When the detrusor muscle contracts inappropriately, causing an individual to have little time…

A: The detrusor muscle is a smooth muscle found in the walls of the urinary bladder. It plays an…

Q: Ch. 8: Which of the following conditions might affect an uncircumcised male, but would not affect a…

A: INTRODUCTION Circumcision This is a procedure in which the foreskin is removed just behind the head…

Q: Explain the mechanisms for which the leaf water potential would be more negative at midday than at…

A: Water potential is defined as the potential energy of water in a system compared to pure water, when…

Q: true or false: Tus sequences are involved in termination of E. coli DNA replication

A: In Escherichia coli, oriC serves as the starting point for bidirectional DNA replication. As a…

Q: What is templating?

A: Templating is a process that uses an existing biological structure as a template to create new…

Q: This bacteria is commonly found in soil and water, and can cause otitis externa (aka swimmers ear).…

A: Introduction:- Bacteria are the prokaryotic organisms that causes various types of infections or…

Question

apply the basic principles underlying the structure of the cell membrane and proteins to understand the nature of electrical excitability in cells?

Neurons
Dendrites
Signalling Direction
Axon
(Diameter 1-20μm Length 1mm-20m
Cell Body
Terminal Branches
of Axon

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Glia that provide myelin for neurons in the brain are called _____________. Schwann cells oligodendrocytes microglia astrocytes
Stellate cells initially process sensory input to the cortex, whereas pyramidal cells send fibers from the cortex to terminate on efferent motor neurons. (True or false)
Watch this video (http://openstaxcollege.org/l/motorpathway) to learn more about the descending motor pathway for the somatic nervous system. The autonomic connections are mentioned, which are covered in another chapter. From this brief video, only some of the descending motor pathway of the somatic nervous system is described. Which division of the pathway is described and which division is left out?
Neurons contain ________, which can receive signals from other neurons. a. axons b. mitochondria c. dendrites d. Golgibodies
Dorsal root ganglia contain _______ of sensory neurons. a. cell bodies b. axon terminals c. dendrites d. all of the above
Skeletal muscles are controlled by ______ . a. sympathetic neurons b. parasympathetic neurons c. somatic motor neuron d. somatic sensory neurons
View the University of Michigan Webscope (http://openstaxcollege.org/l/nervefiber) to see an electron micrograph of a cross-section of a myelinated nerve fiber. The axon contains microtubules and neurofilaments, bounded by a plasma membrane known as the axolemma. Outside the plasma membrane of the axon is the myelin sheath, which is composed of the tightly wrapped plasma membrane of a Schwann cell. What aspects of the cells in this image react with the stain that makes them the deep, dark, black color, such as the multiple layers that are the myelin sheath?
Regeneration of a severed axon has a better chance forsuccess in the PNS than in the CNS. Why is regeneration inthe CNS less likely to succeed?
Gray matter consists of... cell bodies, dendrites, and unmyelinated axons myelinated axons unmyelinated axons myelinated cell bodies, dendrites, and axons
Neuron(key terms: dendrites, axons, electrical signals, communication) This feature of the neuron helps it do its job because
For a neuron to fire an action potential, its membranemust reach ________.a. hyperpolarizationb. the threshold of excitationc. the refractory periodd. inhibitory postsynaptic potential
Cell bodies of UMN that synapse on LMN lie in all of these areas EXCEPT a) Medulla b) Thalamus c) Pre-motor cortex d) Pons e) Primary motor cortex