Once cloning is complete, a recombinant OXA-M290 protein can be produced in E. coli. Competent E. coli BL21(DE3) cells are transformed with the pET-28a-OXA-M290 plasmid, and the transformed cells are grown on an agar plate that contains kanamycin. The E. coli BL21(DE3) cells transformed with the pET-28a-OXA-M290 vector are next grown in liquid growth media that contains kanamycin. Once the culture reaches an OD600 of 0.6, isopropyl β-D-1-thiogalactopyranoside (IPTG) is added to a final concentration of 0.5 mM to induce protein production. How does the addition of IPTG result in the transcription of genes that are regulated by the T7 promoter in E. coli BL21(DE3) cells? [4 – 6 sentences suggested] For Context ONLY: For this biology course and based on the results obtained from a previous BLAST search, the bacteria responsible for the infection at a Hospital is most likely a new strain of Escherichia coli. This strain is given the name E. coli AFB. Earlier, BLAST was used to study a resistance gene from E. coli AFB. These analyses suggest that this strain produces a new β-lactamase, which is given the name OXA-M290. Also, primers were designed to amplify the gene encoding OXA-M290 by PCR. The next step is to clone the PCR-amplified OXA-M290 gene into an expression vector, so that recombinant OXA-M290 protein can be produced and studied. You will start by going over the process of cloning the OXA-M290 gene into pET-28a. Be sure to reference a plasmid map for pET-28a. Here is the nucleotide sequence for the OXA-M290 gene: >OXA-M290 ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG AGCAAGATGCTACATGCTTTCGATTATGGTAATGAGGACATTTCG GGCAATGTAGACAGTTTCTGGCTCGACGGTGGTATTCGAATTTCG GCCACGGAGCAAATCAGCTTTTTAAGAAAGCTGTATCACAATAAG TTACACGTATCGGAGCGCAGCCAGCGTATTGTCAAACAAGCCATG CTGACCGAAGCCAATGGCGACTATATTATTCGGGCTAAAACTGGA TACGATACTAAGATTGGCTGGTGGGTCGGTTGGGTTGAACTTGAT GATAATGTGTGGTTTTTTGCGATGAATATGGATATGCCCACATCG GATGGTTTAGGGCTGCGCCAAGCCATCACAAAAGAAGTGCTCAAA CAGGAAAAAATTATTCCCTAG
Molecular Techniques
Molecular techniques are methods employed in molecular biology, genetics, biochemistry, and biophysics to manipulate and analyze nucleic acids (deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)), protein, and lipids. Techniques in molecular biology are employed to investigate the molecular basis for biological activity. These techniques are used to analyze cellular properties, structures, and chemical reactions, with a focus on how certain molecules regulate cellular reactions and growth.
DNA Fingerprinting and Gel Electrophoresis
The genetic makeup of living organisms is shown by a technique known as DNA fingerprinting. The difference is the satellite region of DNA is shown by this process. Alex Jeffreys has invented the process of DNA fingerprinting in 1985. Any biological samples such as blood, hair, saliva, semen can be used for DNA fingerprinting. DNA fingerprinting is also known as DNA profiling or molecular fingerprinting.
Molecular Markers
A known DNA sequence or gene sequence is present on a chromosome, and it is associated with a specific trait or character. It is mainly used as a genetic marker of the molecular marker. The first genetic map was done in a fruit fly, using genes as the first marker. In two categories, molecular markers are classified, classical marker and a DNA marker. A molecular marker is also known as a genetic marker.
DNA Sequencing
The most important feature of DNA (deoxyribonucleic acid) molecules are nucleotide sequences and the identification of genes and their activities. This the reason why scientists have been working to determine the sequences of pieces of DNA covered under the genomic field. The primary objective of the Human Genome Project was to determine the nucleotide sequence of the entire human nuclear genome. DNA sequencing selectively eliminates the introns leading to only exome sequencing that allows proteins coding.
Once cloning is complete, a recombinant OXA-M290 protein can be produced in E. coli. Competent E. coli BL21(DE3) cells are transformed with the pET-28a-OXA-M290 plasmid, and the transformed cells are grown on an agar plate that contains kanamycin.
The E. coli BL21(DE3) cells transformed with the pET-28a-OXA-M290 vector are next grown in liquid growth media that contains kanamycin. Once the culture reaches an OD600 of 0.6, isopropyl β-D-1-thiogalactopyranoside (IPTG) is added to a final concentration of 0.5 mM to induce protein production.
How does the addition of IPTG result in the transcription of genes that are regulated by the T7 promoter in E. coli BL21(DE3) cells? [4 – 6 sentences suggested]
For Context ONLY:
For this biology course and based on the results obtained from a previous BLAST search, the bacteria responsible for the infection at a Hospital is most likely a new strain of Escherichia coli. This strain is given the name E. coli AFB.
Earlier, BLAST was used to study a resistance gene from E. coli AFB. These analyses suggest that this strain produces a new β-lactamase, which is given the name OXA-M290. Also, primers were designed to amplify the gene encoding OXA-M290 by PCR.
The next step is to clone the PCR-amplified OXA-M290 gene into an expression vector, so that recombinant OXA-M290 protein can be produced and studied. You will start by going over the process of cloning the OXA-M290 gene into pET-28a. Be sure to reference a plasmid map for pET-28a.
Here is the
>OXA-M290
ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT
ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT
TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG
CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA
CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC
AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC
CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG
AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG
CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG
AGCAAGATGCTACATGCTTTCGATTATGGTAATGAGGACATTTCG
GGCAATGTAGACAGTTTCTGGCTCGACGGTGGTATTCGAATTTCG
GCCACGGAGCAAATCAGCTTTTTAAGAAAGCTGTATCACAATAAG
TTACACGTATCGGAGCGCAGCCAGCGTATTGTCAAACAAGCCATG
CTGACCGAAGCCAATGGCGACTATATTATTCGGGCTAAAACTGGA
TACGATACTAAGATTGGCTGGTGGGTCGGTTGGGTTGAACTTGAT
GATAATGTGTGGTTTTTTGCGATGAATATGGATATGCCCACATCG
GATGGTTTAGGGCTGCGCCAAGCCATCACAAAAGAAGTGCTCAAA
CAGGAAAAAATTATTCCCTAG
Step by step
Solved in 3 steps
