Part A Which of the following statements concerning restriction enzymes is true? Select all that apply. ►View Available Hint(s) ☐ Restriction enzymes specifically target and cut RNA in a sequence-specific manner. Restriction enzymes occur naturally in viruses as a defense mechanism against bacteria. Some restriction enzymes generate overhangs in the target DNA sequence upon incubation. During a cloning experiment, the vector and target DNA should be cut with different restriction enzymes to ensure that sticky ends are generated. Submit

Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA?

Restriction enzymes are referred to as "molecular scissors", justify that

Table 21.3 describes the cleavage sites of five different restrictionenzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The efficiency of sticky ends binding together depends on the number of hydrogen bonds; more hydrogen bonds makes the ends “stickier” and more likely to stay attached. Rank these four restriction enzymes from Table 21.3 (from best to worst)with regard to the efficiency of their sticky ends binding to each other.

Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount ofa restriction enzyme for a very short period of time.a. Would the resultant fragments be longer or shorteror the same size as those produced by a completedigestion?

Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions   5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’   a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest?     b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect?   2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a)  HpaI, recognizes 5’ GTT – AAC 3’   5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’   Number of fragments of DNA:…

In 5 sentences only, What are restriction enzymes (RE)? Describe how a RE can be used to develop/design a DNAmarker.

Many studies have linked plasmids to bacterial resistance to antibiotics.  Closured circular segments of double-stranded DNA, plasmids have several restriction enzyme cut sites along with genes that give the cell advantageous characteristics.  Do you believe that fighting widespread antibiotic resistance may be accomplished by focusing on these specific DNA segments?   In one or two paragraphs, formulate a well-supported opinion.   Can you please provide a citation as well

Describe the nature of recognition sites for restriction enzymes and the nature of the ends of the DNA that are left.  Why do we need to run a gel electrophoresis after enzyme digestion

Calculate the average sizes and numbers of DNAfragments produced by digesting human genomic DNAwith a given restriction enzyme.