-pecies 1 is described as 2n = 8 and has chromosome composition BBDDEEHH. pecies 2 is described as 2n = 10 and has chromosome composition NNPPSSXXZZ. elect the best answer to classify the organism below based on its chromosome composition. Note that each letter epresents a chromosome and that the organism below is either an individual from one of the species above or is derived om one or both species above. rganism: BBDEEHH elect one: a. Haploid Ob. Diploid c. Double Trisomic Od. Autotriploid e. Double Monosomic f. Monosomic g. Allotriploid h. Autotetraploid i. Allotetraploid j. Nullisomic k. Trisomic

Q: is i 5' AACGATGCCATCAGAGCCCAGGACGTGATTTAA TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT Ċ (c) wha 3' 5' se that…

A: Transcription is a process in which mRNA is  synthesized with the help of DNA by the help of the…

Q: Select the features of a eukaryotic mRNA that are not encoded in the genome. Select all that apply.…

A: The central dogma theory is an important concept in molecular biology that explains the flow of…

Q: Viruses without borders" is what it means? What's the reason that viral infections are going up as…

A: Viruses without borders" means that viral infections don't respect geographical boundaries. They can…

Q: The allele for long eyelashes (t+) is dominant to short eyelashes. The allele for thick bones (r+)…

A: If two genes are located on the same chromosome then they are classified as linked genes. In this…

Q: Which of the following best describes a coenzyme?   Small charged ions like Fe2+ that help an…

A: An enzyme is a biological catalyst that lowers the energy of activation for a given reaction that…

Q: Select all CORRECT answer choices regarding the following question: "Which of the following are…

A: Bacteria are prokaryotic, single-celled, heterotrophic organisms. As they are heterotrophic…

Q: For the lipids within the bilayer that comprise the plasma membrane: The hydrophilic ends face…

A: Structure of cell membraneLipid Bilayer-2 layers of phospholipidsPhosphate head is polar (water…

Q: Nucleosomes aggregate and disaggregate a.through the attachment of ubiquitin. b.through the…

A: Nucleosomes are fundamental units of chromatin structure, consisting of DNA wrapped around histone…

Q: Following is a list of constitutents found in eukaryotic cells. Rank each constituent in order, from…

A: Large and sophisticated creatures are made up of eukaryotic cells, which have a nucleus surrounded…

Q: Label the anatomical parts of the root and shoot system of a plant. Place your cursor on the labels…

A: The study of the tissue and cellular makeup of plant organs is known as plant anatomy. When…

Q: Polyethylene glycol (PEG)-conjugated IFNs have superior pharmaceutical properties compared with…

A: Polyethylene glycol (PEG)PEG, short for polyethylene glycol, is a type of substance that is good at…

Q: Sugar residues that are attached to proteins embedded within the plasma membrane, that play a role…

A: The question pertains to a fundamental aspect of cell biology and the structure of the plasma…

Q: external lactose 0000 cell membrane RNA polymerase promoter The role of lac permease is to: lactose…

A: In bacteria, the genes that encode the enzymes of a metabolic pathway are usually clustered together…

Q: Based on these graphs, and assuming head raises of European finches helps watch for predators but…

A: The first graph (a) depicts the relationship between the total head raises of the flock per minute…

Q: Which of the following is true about cystic fibrosis (CF) and the CFTR transporter protein? CFTR is…

A: CFTR or cystic fibrosis transmembrane conductance regulator is a glycoprotein and belongs to the ABC…

Q: simple squamous transitional epithelium stratified squamous (keratin) simple columnar with cilia…

A: The cell is the basic functional unit of all biological entities. These cells combine to make an…

Q: A poison added to an in vitro translation mixture containing mRNA molecules with the sequence 5'-…

A: In the process of protein synthesis, when the ribosome encounters the start codon (AUG) and…

Q: Pre-Lecture Assignment: Ulcer Case Study Helicobacter pylori and the Bacterial Theory of Ulcers Case…

A: H. pylori, short for Helicobacter pylori, is a type of bacteria that can inhabit the human stomach.…

Q: Write down the energy content in kilo-calories (kcal) from one gram of fat, one gram of carbohydrate…

A: In the context of nutrition and dietary science, it is essential to understand the energy content of…

Q: This is an image of skeletal muscle tissue. Identify the structure labeled "A" (a) (b) myosin…

A: Muscles are exceedingly specialized soft tissues that play a pivotal part in creating movement and…

Q: Which of the following technique is FALSE in microscopy? Osmium tetroxide can be used as a fixative…

A: Microscopy is a scientific method employed to observe and analyze objects and structures that are…

Q: Observe the diagram below and answer the following questions: Image Source: Wikimedia Commons…

A: Mitosis and meiosis are the two distinct processes of cell division. When we talk about "cell…

Q: bacterial replication fork

A: This is the site within a bacterial DNA molecule where the replication of DNA occurs actively.This…

Q: Explain why K+ channels not allow Na+ to pass even though Na+ is a smaller ion, and Na+ and K+ are…

A: Potassium channels are specialized membrane-spanning proteins made up of four subunits that create a…

Q: In Drosophila,, the curled mutation (cu, chromosome 3, position 50.0) results in wings that curl up,…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: In dosage compensation, do males sometimes overcompensate or is it always Barr body X-chromosome…

A: Dosage compensation is the process by which the organisms equalizes their genetic expression between…

Q: QUESTION 11 Sensory transduction occurs in: afferent neurons (that are not also sensory cells)…

A: Neurons are the cells of the nervous system that are responsible for the generation and conduction…

Q: AA AS SS otal viduals in these individuals in these individu

A: Population genetics includes the study of genotypic and allelic frequencies within a population.

Q: The average heterozygosity of the European Iguana from 1700 was 0.0567 across many loci. Looking at…

A: Heterozygous refers to a genetic condition where an organism possesses two different versions of a…

Q: sify the following statements into the correct category of HIV. Category A T cell count greater than…

A: HIV or human immunodeficiency virus causes AIDS in humans. HIV is a RNA virus. HIV virus attacks the…

Q: Punctate, errose, lobate, dry, convex, swarming, yellow, and circular are all terms that describe:…

A: Anabolism is a part of metabolism in which simple substances are formed from complex substances.…

Q: A breeding pair of birds receives help raising their young from an unrelated male bird. This…

A: unrelated individuals help raise the offspring of a breeding pair in the case of cooperative…

Q: Rank these amino acids from most to least hydrophobic. COO™ COO™ çoo

A: Think of amino acids as characters in a story. Leucine is the 'shy' one who avoids water, so it's…

Q: Identify the following (explain in 1-3 sentences): Description: Embryonic origin : Function :…

A: The term "embryonic origin" describes the tissue or cell type through which a specific organ or body…

Q: What peptides are expected to be produced when an unknown hormone…

A: Large proteins can be broken down into smaller peptides by using different kinds of treatments like…

Q: What do the preceding tests tell you about the case?

A: Based on the above inquiries and responses, the accompanying data has been obtained:The blood sample…

Q: Which of the following statements about amino acids is true? A. Twenty two amino acids are commonly…

A: Amino acids are small monomers of protein. Thus we can say that a protein is made up of different…

Q: Differentiate anaerobes from aerobes and describe how they are cultured. Explain how both aerobes…

A: Biofilms are structured communities of microorganisms that adhere to surfaces and are encased in a…

Q: QUESTION 6 Assume that for a certain biploar cell in the retina, glutamate opens potassium ion…

A: A neuron is a specialized cell in the nervous system that transmits information through electrical…

Q: Select all CORRECT answer choices for the following statement: "Bacterial populations..." reproduce…

A: Bacterial reproduction refers to the processes by which bacteria, which are single-celled…

Q: TRH levels TSH levels T, and T levels Antibodies or immunoglobulins present? Goiter present? Is…

A: We are given the table that needs to be filled with the correct range of parameters. Filling in this…

Q: NT GENERATION te/ Gametophyte E IN ADULT ORGANISM R TISSUES PRESENT CELLS/IS WATER NEEDED? EX CELLS…

A: Bryophytes are lower plants that come after algae in the biological classification. Their body is…

Q: For each statement about the trees shown below, indicate whether it is TRUE (1) or FALSE (2). These…

A: The evolutionary links between a set of species, animals, or genes are graphically depicted using…

Q: If the clamp loader on DNA Pol III were not efficient at loading the new clamp, which strand of the…

A: DNA Polymerase III is a complex protein involved in DNA replication. It has several subunits,…

Q: PROBLEM 1 1. What is the chance for a blood type AB man and a type B (heterozygous) woman to have a…

A: Please follow the below hand written steps:

Q: 6. What volume of a 9% NaCl solution is needed to prepare 100 mL of a 0.9% NaCl solution?

A: The serial dilution process is routinely performed in the biology laboratories to calculate the…

Q: You are trying to track a motor protein dynein movement on a microtubule in a cell using GFP-tagged…

A: Microtubules serve as the arena for dynein motor proteins, and these proteins exhibit rapid…

Q: In humans, cystic fibrosis is a disease caused by a recessive allele (). Individuals with normal…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: 2. The following is the sequence of a gene encoding a small protein: GG (d) 5'…

A: Chromosome is a thread-like elongated structure that contains numerous genes on it. Genes act as…

Q: Oligotropication nutrient loading. Group of answer choices с True can lead to dead zones because of…

A: In the world of water, where streams flow and creatures swim, there's a delicate balance, like a…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.