The diagram above represents a simplified cladogram. Use this diagram to answer the fallowingquestions:1 Which group represents the Tracheophytes? A, B, C or D2. Which group represents the Embryophytes? A, B, C, or D3. Which group represents the Spermatophytes? A, B, C, or D Plant Phylogeny Question:AngiospermsGymnospermsFernsLiverwortsHornwortsMossesGreenAlgae

Plant Kingdom is a kingdom which includes green plants that are capable of making food . They are…

Answered: Plant Phylogeny Question: Angiosperms…

Science

Biology

Plant Phylogeny Question: Angiosperms Gymnosperms Ferns Liverworts Hornworts Mosses Green Algae

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter25: Seedless Plants

Section: Chapter Questions

Problem 17RQ: Microphylls are characteristic of which types of plants? mosses liverworts club mosses ferns

See similar textbooks

Related questions

Q: Austria and Luxembourg banned the import of genetically modified cotton seeds by Monsanto as they…

A: Genetic pollution or genetic contamination is the unintentional introduction of genetically…

Q: What are the advantages and disadvantages of having a Moist, permeable skin in amphibians?

A: ANSWER;- advantages;- Most amphibians have thin skin that is very permeable (allowing fluids and…

Q: Which of the following is an example of positive feedback? Arterial blood pressure homeostasis.…

A: This question is about positive feedback.

Q: Nutrients (such as N, P. K) are important for the increase in net primary production which will be…

A: Different macro and micronutrients are responsible for inducing the growth and reproduction of the…

Q: Phenotype Genotype Temperature-sensitive allele Barr Body Dimorphism Cytoplasmic segregation Sum…

A: Genetics is the investigation of genes and heredity-of how certain characteristics or attributes…

Q: Discuss "The respiratory pathway is an amphibolic pathway."

A: An amphibolic pathway basically refers to the pathway which incorporates both anabolic and catabolic…

Q: What is the importance of plasma proteins?

A: Definition- Mixture of simple proteins, glycoproteins, , lipoprotein are present in the plasma of…

Q: How does the protein encoded by the KanR gene inactivate kanamycin? O by rapidly pumping the…

A: Kanamycin inactivation :-

Q: Why are food chains relatively short? O Not enough energy is transferred from one trophic level to…

A: Food chain can be defined as a transfer of food energy from producers(first trophic level)from one…

Q: If living cells were produced in a test tube from nonbiological components by chemical processes,…

A: The first cells that appeared on the earth are believed to be prokaryotic heterotrophic and are…

Q: When the second ATP is regenerated from ADP during the contraction cycle, what happens? 1.myosin…

A: * Muscle contraction occurs when thin actin and thick myosin filaments slides each other which is…

Q: Why is the colour of a leaf kept in the dark frequently yellow, or pale green? Which pigment do you…

A: The plants contain chlorophyll pigment that helps in photosynthesis process which involves…

Q: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals have…

A: Since phenylketonuria is caused by recessive allele, we have, People with genotype AA - normal /…

Q: Question 3. How is the primer different in eukaryotic DNA replication than prokaryotic DNA…

A: Primer is a small sized single stranded monomeric nucleotide needed by all living creatures to start…

Q: explain properly. How is a species’ population dynamics affected by the presence of another species…

A: A species ecological niche can be defined as the range of resources and the conditions allowing the…

Q: 5. A woman who is a carrier for colorblindness marries a colorblind man. The woman has 5 nngers on…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Which of the following processes contributed the most to the successful evolution of the millions…

A: Due to the evolution process different species are produced. It is a very slow and gradual process…

Q: The seasonal migration of Salmon, beginning life in freshwater, migrating to oceans to grow, and…

A: ▪︎Many types of fishes migrate on a regular basis, ranging from daily to annually or longer, and…

Q: Hello sir, can you summarize, I mean, a short solution, not long?

A: Organ system The human body is designed to perform multitasks and these cannot be done by a single…

Q: Which antibiotic would be a good choice for treating a systemic (in the blood) MRSA infection

A: Methicillin-Resistant Staphylococcus aureus MRSA is a gram-positive bacteria. It is named so as it…

Q: Give information about extensive drug-resistant tuberculosis (XDR-TB) cases in the Philippines.

A: XDR-TB is a rare disease which is resistant to different drugs such as isoniazid, rifampin etc. It…

Q: If a male runner's maximum oxygen uptake in a minute (VO2max) is 3.6 L/min, his maximum energy…

A: Maximum energy expenditure when a perso utilized 3.6 leter oxygen per minute. Given data:-…

Q: In the figure, if a plant and human mitochondrial genome contain the same gene (homolog), did they…

A: If a plant and human mitochondrial genome contain the same gene (homolog), they likely inherit the…

Q: The number and complexity of gene families linked with cell adhesion and cell signaling pathways has…

A: Introduction:- A gene is found mostly physical and functional unit of heredity. Gene are made by DNA…

Q: 2 10

A: A microtome is specifically the device used for cutting thin slices of tissues from blocks of tissue…

Q: • Draw a cyanobacteria cell. • Label the parts of the cyanobacteria where the metabolic processes…

A: Introduction Cyanobacteria are also known as blue-green bacteria are a phylum of Gram-negative…

Q: in general, how does the location and abundance of regulatory DNA sequences change with increasing…

A: Introduction A genome is an organism's complete set of genetic instructions, It consists of…

Q: .... Several set of terms are used to indicate the direction and position when describing the…

A: Some standard anatomical terms of location are used to describe the anatomy of animals including…

Q: Which of the following is TRUE about immunofluorescence microscopy where we localize proteins using…

A: * Immunoflurescence microscopy is used to light microscopy with a fluorescence microscope which is…

Q: Evaluate, using examples from the past, how organisms might or might not be expected to adapt to…

A: Long-term changes in temperature and weather systems are referred to as climate change. Although…

Q: 16. Tamaraw has been in the critically endangered list since the year 2000. One of the reasons is…

A: Introduction A species is often defined as a group of animals, plants, or other living things that…

Q: What features of primate hands and feet are adaptations to an arboreal existence?

A: Introduction Taxonomy is the branch of science that deals with the classification of organisms into…

Q: How do predator populations "mold" prey populations? Support your answer with evidence from your…

A: Predator is the organism which eats other organism, and prey is the organism which is food of…

Q: An organism's life history traits influence its... O Diet O Reproduction O Survival Reproduction and…

A: Life-history traits include the traits or characteristics like size, growth rate or age.

Q: What are the four requirements for chemical evolution, and why is each essential?

A: Chemical evolution can be defined as the changes that occur during the course of development when…

Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: 20.Which of the following contain cells that facilitate the secondary growth or the growth in…

A: Question : 20. Which of the following contain cells that facilitate the secondary growth or the…

Q: Define RQ. What is its value for fats?

A: RQ stands for respiratory Quotient. It is the volume of carbon dioxide liberated over the volume of…

Q: How many mice would you expect to be homozygous dominant and heterozygous for

A: Dominant and recessive alleles alleles that can be expressed only when present in homozygous…

Q: Of what significance is the difference in color of the dorsal and ventral surfaces of the body? What…

A: A coloration is a diagnostic tool for figuring out mammals, however, inquiry into its characteristic…

Q: Now try a few on your own: 1 These three couples are trying to predict their offspring's chances of…

A: Punnet square is a graphical representation by which we can calculate the probablity of all possible…

Q: What is the significance of atrio-ventricular node and atrio-ventricular bundle in the functioning…

A: Introduction Significance of atrioventricular node and atrioventricular bundle in the functioning of…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

Q: What is one way that plants can respond adaptively to cold temperatures

A: Plants respond to cold temperatures by activating metabolic pathways that prevent their cells from…

Q: Complete the table with the correct concepts you have learned about the different characteristics of…

A: Introduction Phyla is a group of related living things that ranks above the class and below the…

Q: Which of the following traits are complete dominance, incomplete dominance, X-linked, or sex-linked?…

A: If a dominant character is expressed in heterozygous condition then that shows complete dominance.…

Q: The syndrome of inappropriate secretion of antidiuretic hormone (SIADH) is a disorder of impaired…

A: Primary polydipsia maybe because of harm to the thirst-regulating mechanism within the hypothalamus.…

Q: What happens to the respiratory process in a man going up a hill?

A: Introduction In this question we will discuss about the effect on respiratory process in a man going…

Q: Could hawthorn and apple maggot flies be considered an example of assortative mating? Explain your…

A: Assorting mating is a type of mating in which the organism mates with another organism that has…

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

TOPIC: SEEDLESS VASCULAR PLANTS IDENTIFICATION 1. Type of leaves that are generally larger in size and has complex venations. 2. This group is characterized by the presence of an nonvascularized root in the form rhizoids, presence of a dichotomous branching stem which resembles a whisk. 3. More commonly known as vascular plants, this refers to a large group of land plants with lignified tissues for conducting water and minerals.
TOPIC: SEEDLESS VASCULAR PLANTS IDENTIFICATION 1. The megaphyll type of leaves in ferns that both function as a photosynthetic and reproductive organ. 2. The heart-shapedflat structure in the gametophyte generation of ferns. 3. The main organ for photosynthesis in higher plants.
Plant family with showy flowers, many stamens, three-parted apocarpous gynecium and only one genus, two species in California______________________?
TOPIC: SEEDLESS VASCULAR PLANTS IDENTIFICATION 1. The dominant stage in the life cycle of ferns, horsetails and whisk ferns. 2. This refers to a moss-like vascular plant with prostrate stems and has strobili that bear two types of spores. 3. These are cell wall impregnations in the endodermis of higher plants that enables the route of water and nutrients to flow via the plasma membrane.
Linnean- or rank based classification systems have placed the cycads, ginkgo, conifers and gnetophytes, respectively, into separate categories, of equal ranking (i.e., each gymnosperm group a Phylum or Division). Is the Linnaean classification of each gymnosperm group justifiable, based on the information shown in the figures?
4 need handwritten cursive answer Clade: Basal Angiosperms Order: Piperales Family: Aristolochiaceae Representative species: Aristolochia gigantea Habit: Inflorescence: Floral Symmetry: Number of Sepals: Number of Petals: Number of Filaments: Number of Stigma: Ovary position: Fruit type: Other characteristics:
floral diagram for taraxacum
3 need handwritten cursive answers Clade: Basal Angiosperms Order: Caryophyllales Family: Caryophyllaceae Representative species: Eremogone congesta Habit: Inflorescence: Floral Symmetry: Number of Sepals: Number of Petals: Number of Filaments: Number of Stigma: Ovary position: Fruit type: Other characteristics:
Pteridophyta(Fern) Alternation of Generation. What are the structures in the fern plant life cycle that are diploid?
Diagram of the Cross floral diagram of bougainvillea.
What is the plant variation of: -Mayana flower-Bataw flower-Caballero flower-Dendrobium flower
Angiosperm-Eudocotes: FAGALES, BRASSICALES, MALVALES, MYRTALES AND SAPINDALES Species in terms of plant habit, reproductive type (monoecius/dioecius), leaf type, leaf shape, floral characteristics, fruit morphology, seed size/shape, and other distinct features.