How does the protein encoded by the KanR gene inactivate kanamycin? O by rapidly pumping the kanamycin out of the cell O by hydrolysis, which degrades kanamycin by covalently bonding a phosphate group to kanamycin O by encoding a mutant ribosomal protein that is not inactivated by kanamycin

How does the protein encoded by the KanR gene inactivate kanamycin? O by rapidly pumping the kanamycin out of the cell O by hydrolysis, which degrades kanamycin by covalently bonding a phosphate group to kanamycin O by encoding a mutant ribosomal protein that is not inactivated by kanamycin

Name: How does the protein encoded by the KanR gene inactivate kanamycin?O
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: How does the protein encoded by the KanR gene inactivate kanamycin?O by rapidly pumping the kanamycin out of the cellO by hydrolysis, which degrades kanamycinby covalently bonding a phosphate group to kanamycinO by encoding a mutant ribosomal protei

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced.Gcn4 translation however is increased.what would happen under high and lowamino acid conditions if only one of the upstream ORFs were deleted from Gcn4?
Human histone H1 protein has the protein sequence as shown as “KKASKPKKAAS- KAPTKKPKATPVKKAKKKLAATPKKAKKPKTVKAPVKASKPKKAKPVK” Please propose pathway the degradation of this protein.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Examination of the histone modifications of a gene reveals an abundance of histone H3 with lysine 27 modified with a single methyl group. Does this suggest that this gene is activated or repressed? How would your answer change if many lysine 27 residues were modified with three methyl groups each?
One important demonstration that Bicoid is an anteriordeterminant came from injection experiments analogousto those performed by early embryologists. These experiments involve the introduction, by direct injectioninto the egg, of components such as cytoplasm froman egg or mRNA that is synthesized in vitro. Describeinjection experiments that would demonstrate thatBicoid is an anterior determinant
MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene. The TATA box and kozak sequences are shown in parenthesis. Wild-type: 5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ What is the resulting polypeptide from the wild-type protein?
Examination of the histone modifications around a gene reveals an abundance of histone H3 with lysine 27 modified with three methyl groups. Does this suggest that this gene is activated or repressed? How would your answer change if many lysine 27 residues were modified with acetyl groups?
Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
What is the mrna codon that corresponds with binds to the anticodon of this trna molecule ccg ggc accounting ugg cgg?A bacterial is the nontranscribed region of the dna to which rna polymerase binds in order to initiate transcription?What happens during the elongation stage of dna transcription what is the function of rna polymerase?
A significant number of mutations in the HBB gene that causehuman β thalassemia occur within introns or in upstream noncodingsequences. Explain why mutations in these regions oftenlead to severe disease, although they may not directly alter thecoding regions of the gene.
A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?