Q: Do humans have plasmids?
A: Plasmid is the small, circular or linear and extra-chromosomal DNA. It naturally exist in bacterial…
Q: Lvris and Irelation of DNA from Ranana)
A: To study the genetic build up of an organism, it is important to know the traits it possesses. Based…
Q: DNA Whic corres A. AC B. UG. В. C. UGA D. ACU
A: The process of producing proteins from DNA - deoxyribonucleic acid - sequence involves two major…
Q: A segment of DNA that reads from the same forward and backward is calleda) Palindromic DNAb)…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: DNA replication occurs in short fragments
A: DNA replication is a semi-conservative process of copying one deoxyribonucleic acid (DNA) strand and…
Q: The small circular pieces of DNA that can be transferred into bacteria are called
A: DNA is the hereditary material present in human beings and most other organisms. It is a molecule…
Q: Multiple sites of replication allow cells to duplicate their DNA ________________.
A: DNA DNA is a long chain of polynucleotides molecules. DNA is either single stranded or double…
Q: In some virus,DNA is synthesised by using RNA as template.such a DNA is called?
A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…
Q: Bacteria are friends of man. Discuss.
A: The bacteria are single celled prokaryotic organism belongs to kingdom Monera. Bacteria include two…
Q: Choose the combination of answers that most accurately completes the statement. Which gene is…
A: Which gene is incorporated into plasmids to detect recombinant cells?
Q: O free-living prokaryotes
A: Free-living prokaryotes
Q: Plasmids are __________ DNA molecules that replicateautonomously and can be transferred between…
A: Deoxyribonucleic acid (DNA) is the most important biomolecule that stores the genetic information of…
Q: 767 B C A C T A A G G G (!!! : A D
A: DNA structure DNA is deoxyribonucleic acid , structures of DNA is double helix made of two…
Q: _refers to copies of plasmid inside host cells.
A: Cloning is the process or the technique, scientists use for creating a genetically identical clone…
Q: O Bacteriophage
A: Virus is there small particles that need the host for its reproduction and prolongation.
Q: Conjugation is the uptake of DNA from the environment. true or false
A: The correct response to this particular question will be, False
Q: Compare and contrast bacteria cells and viruses.
A: Microscopic organisms occur as “uni-or multi-cellular” along with cluster of cells. There are…
Q: Cultivation of viruses in prokaryotic hosts and animal cells as hosts.
A: To isolate and identify viruses in clinical samples is the main goal of virus culture. to conduct…
Q: Is a nucleus cell or virus
A: Nucleus: The nucleus is a membrane-bound organelle in cell biology that is present in eukaryotic…
Q: bactericidal antibiotics arrest the replication of bacteria
A: Antibiotics are drug which inhibits the growth of or destroys the microorganisms. Antibiotic are…
Q: What is the role of plasmids in the recent occurrence of bacterial resistance to antibiotics
A: Plasmid is a circular piece of DNA with the capability to replicate independently within the host…
Q: Use the figure of a plasmid below to answer the following questions. 43) Which enzyme was used to…
A: Bacteria contain Chromosomal DNA as a genetic material but apart from that it also possess rounded…
Q: conclusion about ISOLATION OF BACTERIOPHAGES FROM SEWAGE SLUDGE
A: On analyzing the isolated strains of Bacteriophases from sewage sludge, it was found out that almost…
Q: The process of forming RNA from DNA is called a. mitosis. b. DNA replication. c. translation. d.…
A: Transcription is the first step involved in gene expression wherein a small DNA segment is copied to…
Q: Choose the combination of answers that most accurately completes the statement.R factors are…
A: A small, extra chromosomal DNA molecule within a cell is known as plasmid . It can be physically…
Q: Viroids Neither Prions Neither
A: Given is the list of organisms like bacteria, fungi, protozoa, viruses etc. The characteristics of…
Q: A is a virus that infects a bacterial cell.
A: Lets know each of the terms: Retrovirus : They are also viruses which uses RNA as their genetic…
Q: In prokaryotes indecate how the cell ensures that a new round of replication in not initiated before…
A: DNA in prokaryotes specially in bacteria is circular and undergoes a simpler replication process…
Q: Virology:Some viruses replicate better in hypoxic (low oxygen) environment of cancer cells .TRUE OR…
A: A successful viral replication can be achieved by viral infections that rely on the host cells for…
Q: ive a reason why a plasmid is useful for DNA transfer
A: Plasmids are used as vector or delivery vehicles that carries foreign DNA and transfer it into the…
Q: how a scientist could use an electron microscope to identify a virus?
A: Answer: Introduction: Microscope is an optical instrument to study microscopic organisms such as…
Q: _____________ is the process in which viral DNA is incorporated into the host cell genome
A: prophage in the Bacteriophage virus that gets inserted into the host cell. where they cause…
Q: Describe a “plasmid” in 2 sentences or fewer. no copying and paste it . Use your own words
A: A bacteria is a prokaryotic cell that does not have any nuclear membrane to enclose their genetic…
Q: Cyanobacteria have chloroplasts. True False
A: False Cynobacteria do not have chloroplasts
Q: plasmid DNA replication
A: C option is correct. In Hfr cell F factor is integrated into the chromosomal bacteria. During…
Q: DNA and Antibiotic
A: Antibiotic treatment can cause DNA damage, genomic instability, and, as a result, faster bacterial…
Q: Types of DNA inhibitors medicines
A: DNA inhibitors drugs are those chemical formulation that inhibit the DNA and its function.
Q: Is an Episome a plasmid?
A: The bacteria is the unicellular prokaryotic organism that maintains a definite shape since it…
Q: The DNA ligase does NOT play any role in DNA replication DNA repair cutting DNA into fragments the…
A: DNA is one of the two nucleic acids made up of monomer units of nucleotides. DNA nucleotides are…
Q: mutation would be least harr
A: (a) Silent mutations are when the mutations do not have any observable effect on the phenotype of an…
Q: As a scientist, you need to develop an antiviral drug that will affect the attachment of…
A: The T phages are infectious phages that is capable of infecting Escherichia coli. They are lytic…
Q: Second part asks: Explain the roles two of those enzymes would play in obtaining the recombinant…
A: As the second part is asked, so we are answering question 5 only. Genetic engineering, often known…
Q: Viruses structure
A: Virus: It is a microscopic infectious agent that can replicate only inside a living cell. Viruses…
Q: How can plasmids benefit humans?
A: Plasmids are extra-chromosomal, circular, self-replicating, double-stranded DNA molecule. They are…
Q: Which of the following is the most important structure related to microbial attachment?…
A: Bacteria are single-celled prokaryotes ubiquitous in nature. As such, they can be found in different…
Q: From the given option below what is the community of prokaryotes surrounded by slime and adhering to…
A: Prokaryotes are organisms without a nucleus that is connected to a membrane. Eubacteria and…
Q: spirulina cyanobacteria is photoautotroph or heterotroph,
A: Spirulina is a multicellular blue green microscopic algae. It is also called as Arthrospira and has…
Q: Comparison between bacteria from a virus
A:
Step by step
Solved in 2 steps
- Question 1. Restriction endonucleases can be isolated from a number of bacteria. In bacteria restriction endonucleases. a-restrict chromosomal DNA that is heavily mutated b-restrict chromosomal DNA with significant regions that have been Deleted. c-restrict the DNA of invading bacteriophages. d- all of the above Question 2. In a PCR reaction the step in which DNA polymerase replicates the DNA is referred to as a- denaturation b- annealing C- extension d- initiationQUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.Which of the following is NOT correct concerning the initiation of replication in E. coli? Question 29 options: A) It involves a region of the DNA called oriC. B) DnaA proteins bind to the DNA to begin separation of the strands. C) The strands are initially separated at GC-rich regions of DNA. D) Following initial separation, enzymes continue to separate the parental DNA strands around the rest of the chromosome.
- QUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses enzymes called DNA glycosylases to generate an abasic sugar site. C. removes about 10 to 15 nucleotides. D. does not require an endonuclease. E. recognizes a bulky lesion. QUESTION NO. 2 Termination of a prokaryotic transcriptA. is a random process. B. requires the presence of the rho subunit of the holoenzyme. C. does not require rho factor if the end of the gene contains a G-C rich palindrome. D. is most efficient if there is an A-T-rich segment at the end of the gene. E. requires an ATPase in addition to rho factor. QUESTION NO. 3 Eukaryotic transcription A. is independent of the presence of upstream consensus sequences. B. may involve a promoter located within the region transcribed rather than upstream. C. requires a separate promoter region for each of the three ribosomal RNAs transcribed. D. requires that…Question 1: If Precambrian is to Algae then Paleozoic is to ______________; A. Dinosaurs B. Birds C. Flowering Plants D. Fish E. Mountain Ranges Question 2: Which of the following processes is not involved in genetic engineering? * A. DNA polymerases are used to seal the bonds between fragments B. reinserting DNA into living organisms C. recombinant plasmid gets inside a bacterial cell D. cutting out a DNA sequence E. changing a DNA sequence Question 3: In genetic engineering, vectors are needed in the process and play a crucial role because these molecules A. are able to covalently bond and carry foreign DNA into cells B. protect host cells from invasion by foreign DNA C. degrade nucleic acids D. help in replicationWhich of the following statements regarding ionizing radiation is FALSE? Question options: pyrimidine dimers are caused by ionizing radiation x-rays are a form of ionizing radiation gamma rays are a form of ionizing radiation electrons are energized by ionizing radiation chromosomal breaks can result from ionizing radiation ALL of these statements are TRUE Question 7 ________ is the first repair system reviewing newly synthesized DNA, and is performed by DNA polymerase III itself. Question options: Mismatch repair Proofreading SOS response Dark repair Light repair with photolyase Base-excision repair
- Question 35 This enzyme is responsible to cleave the sugar–base bond to delete the modified base, and produce an abasic site during base excision repair Question 35 options: DNA polymerase DNA glycosylase Endonuclease Exonuclease Question 36 Nonhomologous end-joining (NHEJ) repairs DNA lesions that affect both strands Question 36 options: True False Question 37 A DNA variation in which a single nucleotide is changed is called: Question 37 options: Indel Structural variant Single nucleotide polymorphism Copy variantWhich of the following statements regarding mutation is FALSE? Question options: mutations can be caused by certain environmental agents ALL of these statements are TRUE mutations are usually lethal to the organism mutations in somatic ells of multicellular organisms are not passed to offspring through sexual reproduction mutations typically occur during the production or repair of DNA mutations in bacteria are passed to daughter cells Question 3 A(n) _________ mutation involves the substitution of one purine for another purine. Question options: frameshift transversion transduction translocation transformation transitionQuestion 5 In most of the DNA repair processess the end DNA fragments are joined by Question 5 options: DNA Ligase DNA exonuclease DNA polymerase RNA polymerase Question 6 RNA transcription does not happens in: Question 6 options: Nucleus Mitochondria Chloroplast Endoplasmic Reticulum Question 7 Among the following, which one is trans-acting transcription element? Question 7 options: Enhancer Silencer Promoter Transcription factor Question 8 (1 point) The protein-coding genes in nuclear DN
- Question 1 DNA replication is said to be semi-conservative because Question 1 options: each daughter duplex contains one strand from the original DNA duplex and one newly synthesized DNA strand each of the original DNA strands is used as a template by a DNA polymerase to make a complementary DNA strand Replication is not conserved between daughter cells DNA polymerase adds dNMP residues to the free 3′ hydroxyl group of the growing DNA strand Question 3 DNA synthesis is said to be semi-discontinuous because: Question 3 options: Only the Lagging strand is synthesized continuously Only the Leading strand is synthesized continuously Both leading and lagging strands are synthesized discontinuously Replication starts ar replication fork Question 4 Unlike RNA polymerases, DNA polymerases cannot…Question 33 Following is the DNA repair mechanism for double stranded DNA damage: Question 33 options: Base excision repair Nucleotide excision repair Homologous recombination Mismatch repair Question 34 This mechanism allows repair of bulky, helix-distorting DNA lesions: Question 34 options: Base excision repair Nucleotide excision repair single strand break repair non-homologous end joiningWhy do we find multiple, short RNA pieces inserted into the lagging DNA strand during DNA replication? Question 43 options: the DNA polymerase is replaced by the RNA polymerase in these regions for unknown reasons the DNA polymerase doesn't copy flawless and adds sometime uracil instead of thymine to the growing daughter nucleotide strand multiple RNA primers have been added with the help of the primase enzyme to create multiple start sites for the DNA polymerase Retroviruses sometimes like to insert their RNA into the replication fork and favor the lagging strand multiple RNA pieces are most likely found in the leading not the lagging strand during DNA replication