Please answer and explain. Provide references if possible: TOPIC: STAINING FECAL SMEARS 1.) What is the purpose of xylene in the procedure of staining fecal smears?
Q: List a method which can be used to deal with both malnutrition and lifestyle diseases.
A: Introduction We will answer the question in below step
Q: Q4.3. After the rising phase, which ion channel is responsible for action potential returning to its…
A: Introduction An action potential is a rapid rise or an explosion of electrical activity and…
Q: Rain falls on a fertilized agricultural field after a farmer has harvested the crop. Which…
A: Macronutrients of plants include Carbon, Nitrogen, Phosphorous along with the role of water. In…
Q: The adaptive response is a robust and critical component of the immune systemis able to combat…
A: The immune system It is a group of cells, substances, and processes that help protect the skin,…
Q: 22. Single base substitution is A. Point mutation B. Deletion C. Substitution D.…
A: Mutations These are defined as the alterations in the sequence of the DNA due to exposure of…
Q: Choose the letter that DOES NOT BELONG ON THE LIST. A. biodiesel B. crude oil C. coal D. natural…
A: The source of energy refers to fuels available on the earth. There are deposits of different fuels…
Q: - What effect does high temperature have on the fluidity of the plasma membrane?
A: as per our company guidelines we are supposed to answer only first 1 question. Kindly repost other…
Q: What slide preparation technique should you use for the following research goals? Briefly justify…
A: Microscope is an optical instrument which has major application in visualizing very small to…
Q: What type of DNA changes are there for c.316-106C>G mutation. Is it pathogenic?
A: This is showing a type of mutation in which cytosine has been converted into guanine. Cytosine is a…
Q: Concept map on how to use the autoclave and illustrate how it operates.
A: An autoclave is a machine that uses steam under pressure to kill harmful bacteria, viruses, fungi,…
Q: 1. Why do loons have difficulty walking on land? 2. Where do baby loons spend most of their time…
A: Introduction Loons are water birds, range in length from 60 to 90 cm (2 to 3 feet)re members of the…
Q: how does a high complexity habitat influence predator and prey interaction
A: * The relationship between predators and prey is important in structuring ecological communities…
Q: According to the recent malaria report of the Department of Health, Disease and Prevention Bureau…
A: The malarial parasite passes its life cycle I'm two different host's. The man is the intermediate…
Q: The "yoked control" experiments performed during operant conditioning of the aerial respiratory…
A: * A yoked control design in which matched research subjects are yoked by receiving the same stimuli…
Q: Two haploid yeast strains are crossed together, one wild type, the other mutant for 2 linked genes.…
A: * Yeast cells can also undergo meiosis and will divide into four cells called gametes which are same…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: The blood corpuscles are of kinds.
A: This question is based on types of blood corpuscles in the body.
Q: Explain the cell cycle and cell division
A: Answer
Q: 31. Which of the following mechanisms is involved in increasing the sensitivity of a synapse…
A: Signal transduction pathways translate signals received at the cell's surface into cellular…
Q: A Koi fish breeder wants to introduce a variety of colours in his current Koi population. In Koi,…
A: Parent's Genotypes: - Parent 1:- YyBB:- Gametes:- YB, yB Parent 2:- OOgg:- Gametes:- Og Punnett…
Q: nicotinic receptors?
A: Answer :
Q: true or false: a nucleotide’s 5 end provides the energy to synthesize a new strand of DNA.
A: Replication is one of the essential properties of genetic material because the progeny cells should…
Q: Determinants of health are measurable factors that impact health O True O False
A: Determinants of health are a wide range of factors that affect the health of an individual or a…
Q: Construct a comparative matrix on different sterilization methods.
A: In our enterprise groups, it’s vital to have an expansion of sterilization methods so that you can…
Q: Why do you think the researchers removed the genes for the three carbohydrate antigens, pig growth…
A: Commonly used pig breeds in research include Duroc, Yorkshire, Landrace, and crossbreeds. Domestic…
Q: What is mitosis? What is the importance of mitosis?
A: Cell division is the process by which a cell can divide itself into two cells. the process of cell…
Q: Briefly summarize the conventional wisdom (DNA mutation theory) of the cause of cancer. Discuss the…
A: It proposes that successive DNA mutations in a single cell cause cancer (monoclonality). This…
Q: Explain why dichloromethane is a good solvent to remove the fat from the milk? Can you use organic…
A: Dichloromethane is a good option for milk fat removal. The reason is: Dichloromethane is a polar and…
Q: Question 23) For these three situations below, describe whether there are changes in humoral,…
A: MC4 receptors reduce the food intake while elevating energy utilization . Action of this receptor…
Q: During the glucose oxidation, oxygen (O,) is used to oxidize glucose into CO, and water. What are…
A: Glycolysis is step one in the breakdown of glucose to extract electricity for mobile metabolism.…
Q: Systematists prefer to recognize monophyletic taxa rather than polyphyletic taxa. Why?
A: Introduction A phylogenetic tree is a branching graphic that shows the evolutionary relationships…
Q: What are some examples of organs and tissues where mitosis is more frequent, less frequent or…
A: Introduction - Mitosis is a stage of the cell cycle in which duplicated chromosomes are split into…
Q: A strictly fermentative bacterium produces ATP A. by glycolysis only. B. by photosynthesis only. OC.…
A: Introduction The process of respiration can be aerobic or anaerobic. The process of anaerobic…
Q: G-protein-coupled receptors (GPCRS) all have a similar cture nains. When a GPCR binds an…
A: The structure of activated beta-2 adrenergic receptor in complex with Gs confirmed that the Gα binds…
Q: Q4.6. If calcium ions, each of which has a charge of +2 (Ca2*), moved OUT OF a neuron, and no other…
A: The Charge of the ion depends on the type of charge present on the moving ion. The Concentration…
Q: What is the role of the sulfuric acid in the Zak- Henley's method?
A: The serum is the blood plasma without the clotting factor. After sufficient coagulation, the serum…
Q: The blood corpuscles are of, kinds. a) 5 b) 4 c) 2 d) 3
A: Introduction - Blood is a bodily fluid found in the circulatory system of humans and other animals…
Q: Select all the factors that influence the positive incentive value of eating. a. Flavor of food b.…
A: positive incentive value of food is the pleasure we get after eating a particular food. The main…
Q: Which sentence accurately describes the International Classification of Diseases (ICD) O It focuses…
A: *ICD means International Classification of Disease. It provides method of classifying diseases and…
Q: 1. What causes the light pink to bright red coloraion of most adult flamingos? 2. Please describe…
A: Introduction Flamingos are a type of wading bird in the family Phoenicopteridae, they are very…
Q: 7. RSV is a abiotic stress in plants. 8. RSV produced in the root system of plants improves the…
A: Here I discuss about RSV and their role in plants according to fill in the blank question given.
Q: Blood is stained with stain. a) Methylene blue b) Safranin c) Leishman stain d) Carbol fuchsine
A: Introduction - A blood smear, also known as a peripheral blood smear or blood film, is a thin…
Q: What is the uncontrolled mitotic process that occurs as disease in pluricellular beings
A: Mitosis is a type of cell division process that occurs in the somatic cells of plants and animals in…
Q: Q2/ What is meaning the Nitrification and De-nitrification processes ?
A: Nitrification is a microbial process that which reduced nitrogen compounds (primarily ammonia) are…
Q: what type of stem cells are found in the bone marrow and skin that go through mitosis frequently to…
A: Stem cells are unspecialized cells that has the ability to divide for indefinite periods and give…
Q: Pruning results in a greater photosynthetic area and therefore lesser foods are manufactured? True…
A: Introduction Pruning is when you selectively remove branches from a tree, It allows room for new…
Q: What key features are required for an expression vector that would allow expression of a therapeutic…
A: In molecular biology, expression vector is a plasmid/viral vector for the expression of any…
Q: 4. Consider a fictional radioisotope X (311.1766 amu) a. If a 0,750 g sample of X-311 releases 5.75…
A: ANSWER;-
Q: 1. Substances move through biological membranes against concentration gradients via: a. Simple…
A: *simple osmosis is spontaneous passage of water through a semipermeable membrane * Active…
Q: A person of type A blood receives blood after a collision between a car and a bus. Shortly after,…
A: Blood transfusion is a process of transferring the same type of blood from the donor to the…
Please answer and explain. Provide references if possible:
TOPIC: STAINING FECAL SMEARS
1.) What is the purpose of xylene in the procedure of staining fecal smears?
Step by step
Solved in 2 steps
- Please answer and explain. Provide references if possible: TOPIC: STAINING FECAL SMEARS 1.) What are the advantages of staining fecal smears? Enumerate more than two and explain.Please answer and explain. Thank you! What are the characteristics of an ideal fecal smear in wet mounts?Why should air bubbles be avoided in the preparation of fecal smears?
- In tabular form, summarize the uses and preparations of different classes of inorganic gastrointestinal, topical, dental and miscellaneous pharmaceutical agents included in the current pharmacopeia. Ex: Classifications Examples/Preparations 1. Antacids Al(OH)3 USP Mg(OH)2 USP 2. AntidiarrhealsWhy is NSS preferred over water in preparing fecal smear?How does fluid restriction work as a therapeutic intervention for a patient with heart failure? Please explain detailed pathophysiology
- Direct Fecal Smear: 1. Why is NSS preferred over water in preparing fecal smear? 2. What is the effect of a very thin preparation? Of a very thick preparation? 3. Why do you have to fish the blood or mucoid portion?What is pyrogen ?How to get rid of the pyrogen from the formulation? Please answer at your own easy words. Answer should be to the point.Please help me enumerate the physico-chemical analyses that is required in determining the quality of the squash soup and the standard set by FDA/FAO Codex Alimentarius