Systematists prefer to recognize monophyletic taxa rather than polyphyletic taxa. Why?

Q: 19 Across DOwn 1 Enzyme that "glues" Okazaki fragments together 4 Base that will pair with Thymine 5…

A: DNA replication is the process of producing complementary DNA from the parental DNA molecule.

Q: Killiani Fisher Synthesis

A:

Q: Next, soy contains isoflavones that are phytoestrogens. Define phytoestrogen and describe how the…

A: Phytoestrogens are chemicals produced from plants and are becoming common human and animal diet…

Q: In terms of an electrochemical gradient being produced, compare and contrast any three (3) systems…

A: *An electrochemical gradient is an gradient of electrochemical potential  for ion which can move…

Q: Which of the answer choices is true about ATP synthase? Select all that apply.

A: ATP synthase is a transport protein. ATP synthase is an integral membrane protein.

Q: You were sequencing a region of 200 kb in Effrenium voratum (a member of the family Symbiodiniaceae)…

A: Insulators are the boundary elements that block the activating impact of distal enhancers.…

Q: Match the different methods of analysis with the approaches in Glycomics Study of enzyme…

A: Glycomics is a subset of the field of glycobiology that aims to identify the structure and function…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: Which type of molecule binds at the core promoter sites in association with RNA polymerase? A…

A: RNA polymerase can attach to the polymer by only one method. This method involves binding of Basal.…

Q: Who is Wisdom and what record does she hold? 2. What are salt glands and why do seabirds have them?…

A: 1. I couldn't understand it properly. Probably this will help you...  Wisdom is a literary…

Q: what are the steps in cellular organelles?

A: Organelles are the small structures within the cytoplasm that carry out functions necessary to…

Q: All of the following are functions of connective tissues, except energy and mineral storage.…

A: Introduction Tissue is a collection of cells with similar structures that work together as a unit.…

Q: 21. DNA replication is A. Semiconservation B. Conservative C. Dispersive D. Heteroconservative 22.…

A: DNA is the genetic material of most of the living organisms. Any substances which are capable of…

Q: An enzyme that acts as both a kinase and phosphatase in rxn. of 1 uM 1,3-bisphosphoglycerate,…

A: An enzyme that adds phosphate groups (PO43) to other molecules is known as kinase. Kinases are…

Q: Evolutionary Sciences ask: O "Why" questions O "What" questions "How" questions O "When" questions

A: The main function of evolutionary scientists is how the today's organisms evolved into the current…

Q: Which of the following statements about binding between cytosolic proteins and phospholipids is…

A: The correct answer is option C. By the mechanism of phosphorylation, the phospholipids binding with…

Q: Ultraviolet light principally causes which of the following dmages to DNA? A methylation of specific…

A: UV light can kill cells by damaging DNA to an irreversible extent. The light initiates reaction…

Q: A person of type A blood receives blood after a collision between a car and a bus. Shortly after,…

A: Blood transfusion is a process of transferring the same type of blood from the donor to the…

Q: Which of the following enzymes is responsible for the bulk of DNA synthesis during replication in…

A: DNA pol I,II and III are present in prokaryotes. However it is the DNA polymerase III which is…

Q: Write at least one paragraph about the prevention and control of the following parasites:

A: Parasites are the organisms that lives in or on another organisms called host which were harm by…

Q: anaerobic fates of pyruvate (conversion to lactate or ethanol) in terms of ATP production?

A:

Q: explain what is similar and what is different from the bacteriophages of covid-19

A: Bacteriophages or phages are the viruses that infect and kill bacteria. Bacteriophages consist of a…

Q: Question 43 The DNA strand that serves as a template during transcription is known (other than…

A: DNA transcription is the process by which the coded information from the genome is sent to the cell…

Q: state why simplicity and speed are top priorities in selecting DNA isolation method

A: * Deoxyribonucleic acid that is isolation is the extraction process of DNA from other sources. * The…

Q: Explain why the intersex condition supports the idea that sex and gender are non-binary and that…

A: Sex and gender were once considered synonymous, but in today's world, many people identify with a…

Q: DNA molecule is   A. Acidic   B. Basic

A: I didn't get I have to do just 9th or all  As you didn't mention  But you separately posted 9th…

Q: what to do when you have a stop codon while designing SGRNA for Crispr? I have design SGRNA but it…

A: CDS is a sequence of nucleotides that corresponds with the sequence of amino acids in a protein. A…

Q: Do ostriches bury their head in the sand? 2. Please identify the 3 world records held by the common…

A: Answered 1st 2nd 4th

Q: Question 1 Identify a FALSE statement from the following, O peptidoglycan in Gram negative wall is…

A: Question (1) Answer :-Correct option is (e) lipid A induces activated macrophage yo secret…

Q: How do animals respond to environmental stimuli? How do plants respond to environmental stimuli?

A: Stimulus is basically noticeable / observable changes takes place inside the body of organism . The…

Q: First find and label ATP Synthase on the diagram below. Make boxes and add the labels for ATP, ADP,…

A: Cellular respiration takes place in four steps glycolysis where glucose is converted into pyruvate.…

Q: Question 47 The proofreading of DNA is essential for faithful replication. A) True B) False

A: Proof reading of DNA is essential for maintaining a homogenous DNA across multiple cycles of…

Q: Which of the following is the vestigial bony part of the human skeleton? a) Cervical b) Cranium c)…

A: Introduction - The interior framework of the human body is called the skeleton. It has roughly 270…

Q: For genotype: repP lach lacPt lacO+ lacZt lacY Select the best description of beta-galactosidase…

A: Beta galactosidase is an enzyme which breaks the disaccharide lactose to produce galactos and…

Q: According to the current scientific understanding of the topic, why is our gender identity is NOT a…

A: Gender identity can correlate with a person's assigned sex or can differ from it.In most…

Q: The purpose of this research was not to test the functionality of the transplanted kidneys, but…

A: Kidneys are paired bean  shaped organs. The remove excess water, toxins, wastes from the blood in…

Q: Which sentence accurately describes the International Classification of Diseases (ICD) O It focuses…

A: *ICD means International Classification of Disease. It provides  method of classifying diseases and…

Q: What would a neuropathy of a cervical somatic motor nerve be expected to cause? Brisk reflexes…

A: Peripheral neuropathy:Nerve injury causes weakness, numbness, and discomfort in the hands and feet.

Q: G-protein-coupled receptors (GPCRS) all have a similar cture nains. When a GPCR binds an…

A: The structure of activated beta-2 adrenergic receptor in complex with Gs confirmed that the Gα binds…

Q: Which of the following brain structures helps a person recall things by waking up the areas of the…

A: The brain helps in the controlling of the body so it is known as the control centre of the body. All…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: Question 23) For these three situations below, describe whether there are changes in humoral,…

A: MC4 receptors reduce the food intake while elevating energy utilization . Action of this receptor…

Q: The acquisition of memories can be demonstrated in rodents on a T-maze task. In this task, a food…

A: Homeostasis is extremely important for organism existence. It is frequently seen as a resistance to…

Q: All of the following are muscles that control movements of the eyeball EXCEPT the O A orbicularis…

A: 1) movement of the eyeball is controlled by six extraocular muscles and these are the following:…

Q: A 3-point test cross produces the following numbers of offspring: What gene is in between the other…

A: Genes are DNA sequences of nucleotides that code for RNA, and RNA codes for a protein. In the case…

Q: 1. What is special about the saliva of openbills?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Which of the stated relationships is correct? A. the heart is inferior to the clavicle B. the…

A: Introduction Proximal means close to or near the trunk or the origin of a part (example, the…

Q: Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives.…

A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Q: The electrophoresis gel shown below had a 4th lane (cut off and not shown) which contained 7…

A: Introduction   Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or…

Q: The critical stages when irrigation is needed are during the flowering or early fruiting stage and…

A: Introduction Irrigation is the process of applying water to the crops artificially through various…

Evolutionary lineages

An evolutionary lineage is a series of populations of organisms that descend from a common ancestor. Each species in the lineage is the direct consequence of evolutionary change from a common ancestor. A phylogenetic tree is generally used to display lineages visually. Lineages are components of the phylogenetic tree of life. Molecular systematics procedures are widely used to predict lineages.