Problem 7: Consider three neuron nodes: S1, S2, and S3 with thresholds T1, T2, and T3 given as -0.12, -0.21, and 0.52 respectively. The weights are: W12=W21= -0.4, W23=W32= 0.2, W13=W31= 0.3. The neurons form Hopfield network. Calculate the stable states, show minimum energy wells.
Q: During the Early _______________, life consisted of prokaryotic cells, but by the end of this…
A: The major evolution evens since the origin of the earth have been categorized into three major eras.
Q: Name the components of the formed elements in the blood and mention one major function of each of…
A: Blood and it's components
Q: Why can alcohol kill bacteria? Explain via proteins.
A: Alcohol kills bacteria through The process called as denaturation. Denaturation takes place when…
Q: Which of the following actions would best enable you to demonstrate that the results of an…
A: *steps in scientific method involves the following steps Observation Asking a question Forming an…
Q: 11. One difference between cancer cells and normal cells is that cancer cells A) are unable to…
A: Ans 11. The correct answer for the above question is C) continue to divide regardless if the have…
Q: By now you should be familiar with the following cellular components. Briefly define what they are…
A: Hi! Thank you for the question. As per the conduct code we will answer only the first three parts.…
Q: As a protective mechanism, when this cellular ATP drops, the body takes the fructose and breaks it…
A: Introduction Fructose can be converted to glucose derivatives and stored as liver glycogen, Glycogen…
Q: What do you understand by photoperiodism and vernalisation? Describe their significance.
A: Photoperiodism is the term used to describe the response of plants to the length of time that they…
Q: Highlight the correct answer to the questions pertaining to the coronavirus 1. A type of virus that…
A: 1. 2 Coronavirus 2. 1 No symptoms of a particular disease
Q: A rare disease is found in a family as shown in the pedigree below. Assuming complete penetrance,…
A: Genetic inheritance is the process of transfer of genetic information from the parents to progeny…
Q: 4 4 -20 -15 -10 -5 0 Annual average temp T1. .1. of
A: Bergman's rule relates body size to the animal distribution according to the temperature. According…
Q: species’ population dynamics
A: Population Dynamics is related to ecology ( study of living organisms with relation to…
Q: 1. Causes spurious decrease in MCV
A: Cryofibrinogen
Q: Briefly explain the water absorption rate and time spent in the water absorption response (WR)…
A: Terrestrial amphibians take up water by abducting the hind limbs and pressing a specialized portion…
Q: Diffusion of gases occurs in the alveolar region only and not in the other parts of respiratory…
A: Each alveolus is composed of a thin layer of squamous epithelial cells that are highly permeable and…
Q: 1. Recombinant DNA technology products are now used in various fields, some in agriculture, while…
A: Recombinant DNA technology It refers to the combining of DNA molecules from two distinct species.…
Q: Castle in industrial dairy farms are typically given RBS tea this animal hormone increases a cows…
A: Recombinant bovine growth hormone (rBGH) is a synthetic (man-made) hormone that is marketed to dairy…
Q: 3. Which of the following is true for both NMDA and AMPA receptors? A. They are both only found in…
A: 3. ANSWER;-b) They are both ionotropic glutamate receptors. Explain;- Glutamate receptors. In 2012,…
Q: What is the type of inflorescence of the following plants: Peperomia Shameplant Peacock Flower…
A: A flower is a modified shoot wherein the shoot apical meristem changes to floral meristem.…
Q: What is the correct order of appearance in the fossil record, starting with the earliest: reptiles,…
A: A fossil record is essentially a collection of fossils that have been studied and placed in…
Q: Why is the colour of a leaf kept in the dark frequently yellow, or pale green? Which pigment do you…
A: Introduction In this question we will discuss why the colour of a leaf is kept in dark frequently…
Q: Give the different classes of each phylum. Phylum Echinodermata,Phylum Arthropoda and Phylum…
A: Animal kingdom consists of multicellular, eukaryotic animals. These are animals are divided into…
Q: Fruit What is the type of fruit? What is the arrangement of the placenta? Yardlong Bean Ulam…
A: Placenta, plural Placentas, orPlacentae, in botany, the surface of the carpel (extraordinarily…
Q: What is the mesentery? Why is it now being considered the 79th organ of the body
A: The “new” organ is called the mesentery, and absolutely everyone’s digestive tract has one. The…
Q: Wood duck is one of the most recognizable birds in the United States. In the late winter season, the…
A: Mutation is a change in DNA sequence. Mutation can occur from copying mistakes during cell division.
Q: Define oxygen dissociation curve. Can you suggest any reason for its sigmoidal pattern?
A: Biochemistry is the study of biochemical functions at the molecular and cellular levels using…
Q: Drugs that increase urine flow (diuretic drugs) are oftenemployed in the treatment of hypertension…
A: Kidneys are composed of units called nephrons.
Q: Production of any sort of nitrogenous waste other than ammoniacosts energy. Name at least three…
A: Ammonia, uric acid, and urea are nitrogenous waste products.
Q: Why do we consider blood as a connective tissue?
A: Extracellular matrix (ECM) connective tissues contain cells that are dispersed throughout the…
Q: 19.As observed in animal stem cells, plant meristems are able to? Read and analyze the question and…
A: Stem cells These cell are special cell that have potential to develop into any kind of cell or…
Q: Even though a very few cells in a C4 plant carry out the biosynthetic - Calvin pathway, yet they are…
A: C4 pathway is also known as Hatch - slack pathway which is a photosynthetic process of carbon…
Q: Name the components of the formed elements in the blood and mention one major function of each of…
A: The elements that make up the blood are as follows: (1) Erythrocytes are red blood cells. They are…
Q: Define oxygen dissociation curve. Can you suggest any reason for its sigmoidal pattern?
A: Oxyhaemoglobin saturation curves are graphs that show the percentage saturation of oxyhaemoglobin at…
Q: humans, mutations can be the result of _________________. * A. racial discrimination B.…
A: This question is related to DNA mutations and their causes and wildlife protection and their…
Q: Order the following extravasation-related events as they occur.…
A: The white blood cells are responsible for giving immunity to the body. Different types of WBCs are…
Q: Use the values of the oxygen partial pressure on both sides of the resistance membrane(Po2 = 100,…
A: The pulmonary diffusing capacity for oxygen is the quotient obtained by dividing the volume (ml.) of…
Q: Several set of terms are used to indicate the direction and position when describing the relative…
A: Anatomical directional terms are the terms used to evaluate the particular positioning , location ,…
Q: How do each of the following add to the understanding of the impaired neonate (typically newborns of…
A: Neonatal infections are common complications of extremely low-delivery-weight (ELBW) toddlers…
Q: The brain stem also includes the bulb-like
A: The swollen part of the central nervous system located in brainbox having cavities filled with…
Q: 1. Causes spurious decrease in MCV A. Cryofibrinogen B. hyperglycemia C. autoagglutination D. high…
A: Blood indices are certain tests which helps to determine hameoglobin content , size of RBCs…
Q: Discuss how the social environment contributes to the worldwide DALYS (disability-adjusted life…
A: The act of consuming food in order to assist the body to strengthen its immunity is known as…
Q: What is the importance of plasma proteins?
A: Plasma proteins are a group of proteins that circulate in the blood and play an important role in…
Q: List TWO (2) differences between smooth muscle contraction and skeletal muscle contraction.
A:
Q: Colony shape: round Colony margin: entire
A: bacterial colony is defined as a clump of genetically identical cells that have been derived from…
Q: Under what circumstances could nonhomologous endjoining be said to be error prone?
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: Which vitamins does Devin need to be able to metabolize an alternative fuel to glucose when he…
A: Ketones or ketoacids are a alternative fuel for the body when glucose is in less amount, they are…
Q: Which major organ lies deep to the right hypochondriac region? A. The stomach B. The spleen C. The…
A: An organ is a collection of tissues that structurally form a functional unit specialized to perform…
Q: Tawilis is a freshwater sardine endemic only in the Taal Lake in Batangas province. After several…
A: Tawilis is believed to be a marine fish and has been adapted to freshwater ecosystem. This…
Q: Photosynthesis sustains plant growth and imputes of sunlight sustains photosynthesis why then do…
A: * photosynthesis is the process of making sugars or carbohydrates by the plants and pigment…
Step by step
Solved in 2 steps with 3 images
- Problem 9. Action potentials move along different axons at different speeds. Which of the following would have the fastest rate of conduction? small diameter unmyelinated axon large diameter myelinated axon small diameter myelinated axon large diameter unmyelinated axonProblem 11. The Patellar knee jerk reflex is commonly used for diagnosis of nerve reflex issues ____ True ____ FalseProblem 4 One of the main functions of the brain is dealing with somatic reflexes ____True ____False
- problem21TASK 1: Prepare a 0.020 M Cupric Sulfate Solution.Capacity of volumetric flask provided: 50 mLCalculation of mass required: *(MM = 249.68 g/mol) Show how you will prepare this. TASK 2: Preparation of a Dilutions of 0.020 M Cupric SulfateDilution 1 - Prepare a 1:2 dilution of 0.020 M Cupric Sulfate for a final volume of 200 mL.How much stock is required to make this solution?Question 7 Between threshold and maximal stimuli, I observed: 1. that the force of contraction was most influenced by the placement of the electrode 2. that the force of contraction was unrelated to the magnitude of the stimulus 3. that the force of contraction decreased as the magnitude of the stimulus increased 4. that the force of contraction increased as the magnitude of the stimulus increased
- Question:- 2) You are asked whether a new drug to combat congestive heart failure systems should used .which evaluation method would you use and why? 3). How would you account for the differential timing and costs between a health promotion intervention and a treatment regime? What are the pros and cons of using their technique?Question:- 9. List two possible controlled factors for a study looking at the effect of daily aspirin usage on a heart attack in men.Question: Assume two Silver/Silver-Chloride electrodes are interfacing with human tissue using the Direct contact and Gel-filled contact approaches. In one paragraph, describe which method is the better technique to reduce motion artifacts and explain why.
- What is the basic principle of GPC (gel permeation chromatography)? Q2. In practice, what are the component parts of a GPC system and how they work together? Q3. In application of GPC, what data can you get from the GPC measurements and how can you use them for the estimation of molecular weights?Problem 38Question Multiple. 1. what is he Classification (Chemical and Therapeutic) of Gemfibrozil 2. Drug-drug or drug-food interactions of Gemfibrozil 3. Contraindications, Precautions and Counselling points of Gemfibrozil drug.?