Protien searches are usually more informative than DNA searches. Perform a BLASTP search using RBP4 (NP_006735), restricting the output to Arthpoda (insects). How many database matches have an E-value less than 1.0 in each search ?
Q: Select three from the pictures below and discuss their uses in studying Biology.
A: Biology is a vast subject consisting of a great varieties of organisms and several techniques are…
Q: ustrate how two SMC proteins form a V-shape heterodimer.
A: SMC proteins stand for structural maintenance of chromosomes protein. These are the large family of…
Q: Objective lens X has a limit of resolution equal to 0.2 mm while objective lens Y has 30 µm. a.…
A: * object lens is the optical element which gathers light from object and focuses light rays to…
Q: Explain what eukaryotes are.
A: Answer
Q: What slide preparation technique should you use for the following goals?
A: Slide preparation begins with the fixation of your tissue specimen.
Q: Which of the following statement/s is/are true about gram positive bacteria Cell wall has thick…
A: On the basis of the structure, bacteria can be classified into two main types when they are gram…
Q: Define decomposition and describe the processes and products of decomposition.
A: Inorganic decomposition is the breakdown of complex organic matter or biomass from the bodies of…
Q: Objective lens A has a limit of resolution equal to 0.2 mm while objective lens B has 30 μm. a.…
A:
Q: Which of these is not part of transcription events Polymerase Primer Promoter Sigma factor Uracil
A: The transcription is the process by which RNA is produced from the DNA template. It is the first…
Q: Can you think of a situation where we deliberately want to make a species extinct? How would you…
A: Introduction A species is often defined as a group of animals, plants, or other living things that…
Q: Give a brief account of viruses with respect to their structure and nature of genetic material. Also…
A: Viruses are sub-microscopic infectious agents that can infect and destroy all living organisms on…
Q: Levels of Organization 1. Molecular Level 2. Cellular Level 3. Tissue Level 4. Organ Level 5. Organ…
A: Level or organization shows how the organism are organized into various levels. The very basic level…
Q: The binding of a signaling molecule to its receptor will trigger a series of chemical reactions…
A: The cell in our body has various receptors on the surface of its cell membrane. These receptors can…
Q: 1) Explain why the intersex condition supports the idea that sex and gender are non-binary and that…
A: Sex is usually categorized as female or male but there is variation in the biological attributes…
Q: 9. The pituitary gland releases follicle stimulating hormone (FSH). This hormone stimulates the…
A: The menstrual cycle is the shedding of unfertilized eggs and it begins on the first day of the…
Q: Why are there so many species in the tropical rainforest?
A: Biome is a spot that exhibit a particular weather and hold community of various plants as well as…
Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…
A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…
Q: Why are planktons important in the food chain?
A: Answer
Q: A site of communication between neurons is called a _________ 2. Where is the cerebral spinal fluid…
A: Neurons are also known as fundamental unit of brain and nervous system. The main function is to…
Q: Hydrolytic reaction do not always require the presence of water.
A: The word hydrolytic relates to the other word hydrolysis which means the breakdown process where…
Q: What might be a reason why a Buruli ulcer is initially painless?
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: What is Menopause?
A: Introduction In this question we will discuss about the Menopause.
Q: Discuss the mechanism of action of the enzyme chymotrypsin.
A: Chymotrypsin is a protease enzyme that digests the proteins cleaves the carbonyl side of peptide…
Q: Ana was tasked to measure the actual magnification of her specimen mounted on a slide without…
A: A light microscope or optical microscope is used to study a thin section of a rock. The section is…
Q: Describe the cell below in terms of structure and shape.
A: Lymphocytes are leukocytes that broaden from the common lymphoid progenitor. Although they typically…
Q: Identification
A: The action of regulating salt and water balance (osmotic equilibrium) through barriers in the body…
Q: Many enzymes obey simple Michaelis–Mentenkinetics, which are summarized by the equationrate = Vmax…
A: Michaelis-Menton kinetics is an equation that describes the rate of enzymatic reactions by relating…
Q: A gene is inherited as a X-linked recessive trait. A hemizgous father that has the recessive allele…
A: Genetic problems related with mutations in genes present on the X chromosome can be referred to as…
Q: Bacterial generation times for four different bacterial species were calculated in the media listed…
A: The time it takes for a population of bacteria to double in size is known as generation time. The…
Q: Can you think of a situation where we deliberately want to make a species extinct? How would you…
A: Extinction is the death of a type of organism or a group of organisms, most commonly a species.…
Q: Communications between cells is facilitated by the presence of
A: There are many cells in our body. Each cell needs to communicate with the other. This means the…
Q: How can change in natural resources ripple through asociety?
A: Natural resources are a base for existence of all the living organisms. If natural resources are…
Q: Which of the following part of the human brain has a center for controlling breathing? a) Medulla…
A: Introduction - The brain is a complicated organ that regulates our body's thought, memory, emotion,…
Q: Question 15: Define the following terms and give one example for each: (a) Commensalism (b)…
A: Commensalism: Commensalism is a type of interaction between two species in which one species…
Q: A key result of the pandemic has been the increased scrutiny of scientific research by a broader…
A: Introduction - Despite our public health response to the pandemic's shortcomings, the biomedical…
Q: Substances that contain both hydrophobic and hydrophilic regions are referred to as -__ molecules.
A: On both the inside and outside of the cell, the hydrophilic areas of phospholipids form hydrogen…
Q: (c) Discuss the mechanism of action of the enzyme chymotrypsin.
A: Chymotrypsin is an enzyme used by the digestive system to breakdown the component into smaller…
Q: Describe the structural adaptations that primates have for life in treetops.
A: Any mammal belonging to the primate family, which comprises lemurs, lorises, tapir, apes, gorillas,…
Q: Choose correct answers | Eastern Spruce Budworm (Choristoneura fumiferana) exclusively feeds on…
A: ANSWER) (a) Eastern Spruce Budworm exclusively feeds on spruce. Spruce budworm feeds on the white…
Q: Most living organisms cannot survive at temperature above 45°C°. How are some microbes able to live…
A: Various bacteria have proteins which denature with increasing temperature and coagulate due to which…
Q: BASIC BIOLOGY Funnel Volumetric Flask Graduated Cylinder Beaker Balance
A: 1. Human skeleton model:- These are the primary teaching tools used to teach students and patients,…
Q: 3. You eat a hamburger that you don't really need. The polysaccharides, fats, and lipids in the…
A: Many foods contain high amount of fat and carbohydrates which are broken down in our body into…
Q: What are some biological examples in which lysosomic enzymes play a fundamental role?
A: A digesting enzyme-containing lysosome is a membrane-bound cell organelle. Lysosomes play a role in…
Q: 2. You measure the cross sectional area of the quadriceps of 40 diff gazelle species. How should…
A: While referring to muscles Isometry means iso-same metry-length When proportional relationships are…
Q: True or False.
A: A membrane protein that is stably connected to the cell membranes is known as an integral membrane…
Q: TEXT ANSWER Answer the following three questions based on the diagram below. 1. Which of the…
A: There are two types of organisms based on their types of cells, based on their structure and…
Q: Which uses of animals, if any, are morally permissible, and which are morally wrong?
A: Some animals are friendly and don't harm us while some are wild and don't like to interact with…
Q: Explain the pollination occurring in the chasmogamous flowers.
A: All of the chasmogamous flowers are open and ready for pollination, with their anthers and stigmas…
Q: Glucose is an isomer of fructose only galactose only neither galactose nor fructose invert sugar…
A: Biological macromolecules are the molecule that are needed in enough amount for our body and…
Q: Sawfly larvae differ from Lepidoptera caterpillars | by having more prolegs. | by having…
A: Sawfly larvae ( belonging to order Hymenoptera) are immature stages of wasps or bees that have…
Step by step
Solved in 2 steps
- consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was subjected to pyrosequencing, sketch the expected profile of the sequencing output. Assume that the sequential flooding of nucleotides follows the order G-C-A-T.Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
- Which of the following pairs of sequences would be considered different alleles in DNA profiling? a) ATGAATTCGG; ATGAAATCGG b) ATGAATTCGG; TACTTACTTACT c) GAAGAAGAA; GAAGAAGAAGAA d) AATAATAATAAT; AATTAATTAATTApproximately how large is the Escherichia coli genome in basepairs? How many genes does it contain?When forensic experts work with a blood sample, what part of it do they use for PCR; red blood cells, white blood cells, or proteinaceous antibodies? If trying to find a tandem repeat segment, why would you pick one choice other another?
- The following data shows bisulfite sequencing results for a small region of the genome. How many methylated C's are in the gene? Reference sequence: GAGACCTCG Bisulfite sequencing: GAGACCTTGShown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the original DNA sample used for sequencing? GGTAACC CCAATGG GGTTACC CCATTGG
- In STR DNA typing, a typical DNA pattern shows (two, three) bands.Download BLOSUM30 and BLOSUMB0 substitu- tion matrices and place them side by side on your computer screen. What are the differences between the two matrices? Why do you see these differences?Why a multiple sequence alignment is needed for researchers? What inferences can be derived from this kind of sequence alignments? Explain two extreme cases that are non-informative for the multiple sequence alignment.