True DNA fragment 125 bp The picture above shows that a DNA fragment has R1 (read 1) adapter and R2 (read 2) adapter attached to it and it's ready to go through Illumina paired-end sequencing. If the Illumina sequencer is set to sequence 100 bp for R1 and 100 bp for R2. We will need to trim the adapter sequence from the resulting read generated by the sequencer. True or False? False R1 adapter (45 bp) R2 adapter (45 bp) Question 1 DNA fragment 125 bp R1 adapter (45 bp) R2 adapter (45 bp) 5 pts The picture above shows that a DNA fragment has R1 (read 1) adapter and R2 (read 2) adapter attached to it and it's ready to go through Illumina paired-end sequencing. If the Illumina sequencer is set to sequence 50 bp for R1 and 50 bp for R2. How many bases of the DNA fragment are not being sequenced? 25 25

QUESTION 5 If you ran the amplicon from the previous question (so it's about 3.7k basepairs long), on a gel, what would you want your gel to look like after you stain it with ethidium bromide and look at it under UV, assuming you ran it next to a 1kb DNA ladder? O A. A lot of lighter bands below the 4kb band O B. A very bright band at the bottom of the gel, and a lighter band in the middle of the gel. O C.A bright smear O D. one bright band that lines up between the 3kb and 4kb ladder band. Should be above the 3kb band (closer to the wells). O E. one bright band that lines up below the 3kb ladder band (further from the wells)

Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this DNA sequence: TGCAGACT *record your answer with no spaces, dashes, or other characters

Question 2: - selecting PCR primers The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the two 18'mer oligonucleotides that you would need as primers for amplifying the underlined region? (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence). 5'-AATCCGACCTGATTCTAAAGCGCGCTAAGAGCTACGTAGGCACCCAT GTTGGAAATCTCTTATCGGAGATTTCTTCTTGATTACTGGCCCTATGCAT GTCATTCCATGCCATCGGTATTCTCGATACTTGTACTTGATGCATTCGA-3' Primer 1: 5'- Primer 2: 5'

Question 14 Why are long reads the preferred method to sequence repetitive elements? Select the statement that is FALSE. ◇ If a repetitive region is longer than 300 basepairs (the length of a short read) it's impossible to determine the total length. O Long reads are more likely to span repetitive regions on either side, making it easier to map the repetitive regions. O It's hard to determine where short reads should be placed, as they could map to multiple repetitive regions. O Long reads are less error prone and thus better for sequencing overall. Question 15 Which of the following statements is NOT true about GWAS? When identifying alleles associated with a disease, we compare the frequency of an allele in a control group versus a cash group

Question 6 1 pts You are assembling the genome sequence of a newly discovered bacterium by aligning a set of BAC clones. Correct assembly requires O spacer regions O repeated sequences O overlapping sequences

Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…

Question 8. You isolate the DNA from the bacterial cells and apply the Sanger dideoxy sequencing method. You then separate the products of the reactions by gel electrophoresis and obtain the following pattern. What is the sequence of the template and the DNA on the gel? ddATP ddTTP ddCTP ddGTP Template V [ Choose 3'-CTAGTCAAGG-5' 5'-CTAGTCAAGG-3' Sequence 3'-GATCAGTTCC-5' 5'-GATCAGTTCC-3' 5'-GGAACTGATC-3'

QUESTION 4 After you get your gene block, you do a restriction enzyme digest and ligation reaction with the plasmid/gene, so you can proceed to bacterial transformation! How does the plasmid get into the bacteria though? O You mix the plasmid in lipids with several other plasmids to make lentiviral vector that'll infect all the other cells. O The plasmid will be transmitted through a pilus to the other bacteria. O You make the bacteria chemically competent using calcium chloride, and then subject the cells to heat shock O Bacteria will naturally take up the plasmid so you don't need to worry about it.

Question 2. You have a wild-type strain of E. coli with the genotype A B C D EF You introduce an F+ plasmid into your wild-type strain and isolated a few Hfr derivative strains that you call Hfr1, Hfr2, and Hfr3. You are studying several new genes in E. coli with interesting phenotypes. You obtain a multiply mutant strain with chromosomal genotype: a b c d e f a) You mate each Hfr strain to your multiply-mutant strain in a separate experiment. At various times you interrupt the matings and plate the bacteria under conditions in which only the recipient strain can grow. You obtain the following earliest-time-of-entry data, in minutes: Gene Hfr1 Hfr2 Hfr3 A B C D E F 11 13 7 I 26 16 11 9 5 31 15 27 31 11 Draw a map of these genes that is consistent with the data, including all the genes and Hfr origins, the distances between them (in minutes), and the direction of transfer of each Hfr.