Question 1 of 10 Question 1. You isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.

Question 1 of 10 Question 1. You isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.

Name: Question 1 of 10Question 1. You isolate a mouse Tau-gene-containingDN
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Question 1 of 10Question 1. You isolate a mouse Tau-gene-containingDNA fragment from the chicken and hybridize it to thefreshly-made and isolated hnRNA (primary transcript)from the nucleus of the mouse cells transcribed fromthe Tau gene (immediately

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 34CTQ: Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does...

See similar textbooks

Similar questions

QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.
Question 1. Suppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. The nucleotide length of each exon and intron is shown. The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. E) Suppose you isolate a mutant mouse that has white eyes. When you examine the size of the eye pigment enzyme produced by this mouse, you see that it is 400 amino acids long. Sequence…
QUESTION 1: Several factors (e.g., time and voltage) affect migration of DNA fragments through the agarose gel. Briefly explain how each of these factors affects DNA migration.
QUESTION 9 These are enzymes that untwist the double helix at the replication forks of replicating DNA. Helicases Stingle-strand binding proteins Topoisomerase Telomerase
Question 9 Both conservative and replicative transposition result in movement of the transposon; however, only conservative transcription Group of answer choices A. Transfers the transposition to the new location without copying it B. Has transposase that cuts at inverted repeats and target sequences C. Produces a second copy of the transposon sequence D. Inserts the transposon sequence into target sequences
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
QUESTION 23 Which of the following is not part of pre-mRNA processing in eukaryotes? Addition of a 5’ cap Excision of introns Addition of a 3’ poly-A tail Excision of the promoter
Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)
QUESTION 25 What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA sequences B. Minisatellites C. Exons of genes encoding proteins D. Introns of genes encoding proteins
QUESTION 20 Which of the following is not true with respect to eukaryotic genes? They contain introns which do not code for protein They can exist as operons, with multiple genes under the control of a single promoter They require transcription factors for initiation of transcription Termination sites for transcription are not well defined
QUESTION 21 What is a promoter? The site where the ribosome begins translation The site where RNA polymerase attaches to the DNA in front of the gene. The site where DNA replication begins The site where Okazaki fragments are linked together
QUESTION 48 Identify the best match between the mutation description and term. a. Synonymous mutation: has the potential to cause large changes in transcription and subsequence amino acid sequence due to reading frameshifts b. Nonsense mutation: causes a drastic change in phenotype because the change causes a premature stop in the amino acid sequence c. Indel: a change in the DNA that changes the codon code from one amino acid to another amino acid d. Missense mutation: results in a change in single nucleotide from a purine to another purine or a pyrimidine to another pyrimidine but does not change the amino acid sequence