QUESTION 20Careful TEM studies suggested that histone octamers get removed during DNA replication. This raised a question regarding what happens to the histoneoctamers after they get removed. Do the histone octamers get disassembled after removal, or do they remain intact and get added back onto the DNAwithout disassembly. The figure below outlines an experiment that researchers performed to address this question. In a single sentence, describe theconclusion that can be drawn from this experiment.ExperimentQuestion: What happens to histones in eukaryotic DNA replication?Methods 1 Grow cells for severalgenerations in a mediumthat contains amino acidslabeled with a heavy isotope.2 Transfer the cells to a mediumthat contains amino acidslabeled with a light isotope.ResultsChangemediumReplicationIsolateoctamers3 Isolate histone octamersbefore and after replication...Spin4 ...and subject them to density-Lgradient centrifugation.5 Newly synthesized octamersare less dense and thus will behigher in the tube.6 Old octamers are dense andwill move toward the bottomof the tube.IsolateoctamersSpin

The conclusion that can be drawn from this experiment is that histone octamers remain intact and get…

Answered: QUESTION 20 Careful TEM studies…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

QUESTION 9 These are enzymes that untwist the double helix at the replication forks of replicating DNA. Helicases Stingle-strand binding proteins Topoisomerase Telomerase
QUESTION NO. 1 A transition mutation A. occurs when a purine is substituted for a pyrimidine or vice versa. B. results from the insertion of one or two bases into the DNA chain. C. is most frequently caused by chemicals (like acridine) that intercalate into DNA. D. results from substitution of one purine for another or of one pyrimidine for another. E. always is a missense mutation QUESTION NO. 2 Degeneracy of the generic code denotes the existence of A. multiple codons for a single amino acid. B. codons consisting of only two bases. C. base triplets that do not code for any amino acid. D. different systems in which a given trip let codes for different amino acids. E. codons that include one or more of the unusual bases. QUESTION NO. 3 Replication A. requires that a phosphodiester bond of the incoming dNTP be hydrolyzed in order to be added to the growing chain. B. uses 5' to 3' polymerase activity to synthesize one…
QUESTION NO. 1 Patients with the rare genetic disease xeroderma pigmentosum (XP) are very sensitive to light and are highly susceptible to skin cancers. The study of such patients has enhanced our knowledge of DNA repair because XP is caused by defective DNA repair nucleotide excision repair. (A variant, XP-V, is deficient in postreplication repair.) In nucleotide excision repair A. removal of the damaged bases occurs on only one strand of the DNA. B. only thymine dimers generated by UV light can be removed . C. the excision nuclease is an exonuclease. D. a single multifunctional enzyme carries out the repair process. E. only the damaged nucleotides are removed. QUESTION NO.2 Homologous recombination: A. occurs only between two segments from the same DNA molecule. B. requires that a specific DNA sequence be present. C. requires one of the duplexes undergoing recombination be nicked in both strands. D. involves a…
QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.
QUESTION 12 The leucine zipper domain of transcription factors is not involved in DNA recognition but rather in facilitating dimerization. Given the chemical properties of the amino acid leucine, dimerization of transcription factors via this domain by (select the correct option). Facilitating hydrogen bonding with the aqueous environment. Chelation of bivalent ions such as Zn2+. Formation of coiled-coils through hydrophobic non-covalent interactions between evenly spaced Leu residues in alpha-helical domains. Physically connecting the two transcription factor subunits through unstructured loops.
QUESTION 26 In a double-stranded DNA molecule, how are the sequences of each strand related to each other? A The sequences are identical. B The sequences are identical except that one strand has a U where the other strand has a T. C The sequences are the reverse compliment of each other and use the nucleotides, A, G, U, and C only. D The sequences are the reverse complement of each other.
QUESTION 2 2.1 Recombinant plasmids are often used to produce therapeutic proteins. Elaborate on the steps you would follow to generate a recombinant plasmid that can be used in future toexpress a therapeutic protein of your choice. In your answer, include the important reagents used and their functions. 2.2 Thoroughly explain at least three different techniques you would use to confirm successful recombination in 2.1. In your answer, outline the principle behind each technique. 2.3 With supporting points, outline the Polymerase chain reaction (PCR) technique you would choose to amplify a desired gene from a Retrovirus.
QUESTION 25 What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA sequences B. Minisatellites C. Exons of genes encoding proteins D. Introns of genes encoding proteins
QUESTION 25 During lagging strand synthesis of DNA, the RNA primers are replaced with DNA by __________. DNA Polymerase I DNA Polymerase II DNA Polymerase III Primase
QUESTION 24 During lagging strand synthesis of DNA, Okazaki fragments are linked together by ___________. DNA polymerase I Primase Beta clamps DNA Ligase
Question 44 Along with modification of histones and positioning of nucleosomes, following is one of the main epigenetic mechanisms operating across the genome: Question 44 options: DNA acetylation DNA methylation DNA oxidation DNA phosphorylation Question 45 Changes in our DNA that have not been corrected by cellular DNA repair systems create: Question 45 options: Transcripts DNA variants Polypeptide Polynucleotide Question 46 The degeneracy of the genetic code most often involves: Question 46 options: the third base of the codon the second base of the codon the first base of the codon two bases of the codon
QUESTION 27 Which of the following methods can be used to compare the amounts of one specific mRNA that is expressed by two different cell lines? A. Immunohistochemistry B. Western blotting C. Polymerase chain reaction (PCR) D. Immunocytochemistry

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS