18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would liketo amplify the following gene by PCR.GTAGAATATG ATAAGCGAAA CTGCAAATCG CGTTTGGGGC GATACAAGTA GTGTACGCGGACCGCGCCGA GCGGGCTATG GTTTCTCCAC TATCAGTTCT TCTCCTGTCC CAGCGAAGTCGAGGTCCAGC CCTACGGTAC ATAACTAACA CGGTTTGAAG AAGATACGAT CTTACGAAGTAAAGAAAATT TGTAGTCAGC CCGGTTCGCT TGTGTCCAGC TAATCGATTG ATTGGCCCCAGCAGGCGAGA TGAACATAGT CATGCGCTGT CTAATAGCCC ATTTGACGTG TAGGTGGCGCTTTTATTTCT GAGGTGGAAA Ta) If the primers were both 20 nucleotides long, what are the sequences for both PCR primers that willamplify only the highlighted region? Be sure to label the 5' and 3' ends. (4 points)b) What is the length (in bp) of the entire region amplified by their primers (i.e. the amplicon length)? (Note:the spacing in the above sequence is intentionally uniform) (2 points)c) If you start with 300 copies template DNA how many copies would you expect to produce if you ran thePCR for 22 cycles? Show your work. (4 points)

PCR (Polymerase Chain Reaction) is a laboratory technique used to amplify specific regions of DNA.…

Answered: 18. You want to express hemoglobin beta…

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 2SQ

See similar textbooks

Similar questions

1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
Single stranded DNA fragment of M13 phage DNA shown was mixed with the following primers P1: AGTAG AATTGATGCC ACCTT; P2: TGT CTG GAA GTT TCA TTC CA and incubated in a thermal cycler in the presence of the four dNTPs and Taq DNA polymerase under the PCR conditions.AATGCTACTA CTATTAGTAG AATTGATGCC ACCTTTTCAG CTCGCGCCCC ATAGCTAAAC AGGTTATTGA CCATTTGCGA AATGTATCTA ATGGTCAAAC CGTTCGCAGA ATTGGGAATC AACTGTTACA TGGAATGAAA CTTCCAGACA What is the length of the PCR product? What is the final concentration of PCR product after 10 cycles if the starting template concentration was 1 nM?
The target sequence for a PCR amplification is shown below. When the final cycle of PCR has ended, the resulting amplicon will be how many base pair (bp) long? 5' ACGTGCGAGCACGTATATATGTCGCGTGCTGAGTGTAGCGTATGCGAATCACCGC 3' 3' TGCACGCTCGTGCATATATACAGCGCACGACTCACATCGCATACGCTTAGTGGCG 5' 31bp 39bp 42bp 47bp None of the above
You want to amplify the following sequence of DNA from a gene of interest that you are studying. To do this, you will use PCR. Design a forward and reverse primer. Show where the primers anneal to the template sequence. Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’ TACTGCCTTATATTCGACCACCACCACC---CCGACGTACTCGACGTTCACACACGAGAGGATT 5’ (PLEASE EXPLAIN STEP - BY STEP) Answer : Foward primer 5": Reverse primer 3"
1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
For the DNA sequence shown, indicate the products of its cleavage with the following restriction endonucleases (AKA restriction enzymes):5′-ACAGCTGATTCGAATTCACGTT-3′3′-TGTCGACTAAGCTTAAGTGCAA-5′a) EcoRI (the recognition sequence and cleavage site is G↓AATTC);b) AluI (the recognition sequence and cleavage site is AG↓CT).
Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’
Here another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'
The recognition site of some restriction enzymes are shown. Which will produce sticky ends? A. EcoRI G↓AATTC. B. SmaI CCC↓GGG. C. XhoI C↓TCGAG. D. Both EcoRI and XhoI. E. All the enzymes shown will leave sticky ends.
A linear DNA fragment was produced by digestion with the restriction enzyme, Xba1. This fragment with XbaI(X) sites on both ends was then further digested with HindIII (H) and EcoRI (E). Draw a restriction map of the linear fragment based on the gel electrophoresis results shown below. X H Marker E H/E __2000bp __ __1500b __1300bp __ __ __1000bp __ __700bp __ __500bp __400bp __300bp __ __200bp __ __ __100bp
Recently, I am designing primers specific for Lactobacillus sp. (partial sequence of the 16s rRNA gene) and can get successful amplification on my conventional PCR. Then I am going to quantify by RT-PCR using SyBr Green Reagent in Step One Plus Instrument. By using the same run condition as the conventional PCR, I face the problem that many of my samples got a bad melting curve. Anyone have the same experience as me or suggestion please let me know. Thanks in advance.

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning