Question 26 SHORT ANSVWER (recall) What is the SIZE of an average gene? (give a range, in bp or kb) Gene are relatively small covering • Previous
Q: Question 8 The cloning a eukaryotic gene in a bacterial plasmid does not include extension gene…
A: The advantages of biotechnology for our society can be in drug manufacturing at a low cost using…
Q: Question 15 The process of amino acid activation A involves the formation of a peptide bond between…
A: Introduction Amino acids are molecules that combine to form proteins or the building blocks of…
Q: QUESTION 7 Which sequence is the complement to sequence 5'-AGTTACTAAA-3'? O a. 5'-TCAATGATTT-3'…
A: Ans is... c
Q: Question 8 Electrophoresis in agarose gel A The DNA will migrate to the negative elec- trode due to…
A: Agarose gel electrophoresis is a commonly used laboratory technique to separate the charged…
Q: QUESTION 4 In order to produce mRNA vaccine for COVID19, the DNA encoding the SARS-CoV-2 spike…
A: Designing a primer for amplification of target DNA is an important aspect of primer designing.…
Q: Question 21 Your research team has been tasked with using a variety of horizontal gene transfer…
A: This question is about prokaryotic dna replication
Q: Question 14: You examined 8 mutants, so in theory there could be 8 complementation groups…
A:
Q: Question 10 Review mutations. Match the term and its description. Each term can only be used once.…
A: change in just one nucleotide pair is called a point mutation the mutation that does not have an…
Q: Question 5 To identify genes associated with the movement disorder Parkinson's disease, you decide…
A: Inorder to amplify a double stranded DNA via PCR, we require 2 sets of primer; a forward primer and…
Q: Question 17 Match the following Prompts Submitted Answers Eukaryotic rRNA genes are transcribed and…
A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…
Q: QUESTION NO. 1 Fragile X syndrome is a common form of inherited mental retardation. The mutation in…
A: Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Question 14: You examined 8 mutants, so in theory there could be 8 complementation groups…
A: The analysis has been done in a tabular manner and the growth is represented by black dots. Here…
Q: Question 22 Af the percentage of adenine in a given sample of DNA is 20%, then the ercentage of…
A: Chargaff's rule: He studied the base composition of DNA on variety of sources and proposed the…
Q: Question 36 DNA molecules can perform their function in replication and transcription as long as the…
A: Yes its a true statement . The hydrogen bonds between the bases of the DNA provides the…
Q: QUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to…
A: INTRODUCTION DNA sequencing is that the process of determining the sequence of nucleotides (As, Ts,…
Q: During lagging strand synthesis of DNA, Okazaki fragments are linked together by ___________. a…
A: During the synthesis of DNA, at each replication fork, two strands of DNA are synthesized one is…
Q: Question 33 Given the electrophoresis profile of a Sanger sequencing result, what was the sequence…
A: DNA is the genetic material present in the cell. It stores information in form of nucleotides sub…
Q: Question 10 When bone marrow stem cells are removed from the patient, infected with a virus that…
A: Introduction :- The spongy tissue inside certain of your bones, such as your hip and thigh bones, is…
Q: Question 14 If Guanine is 30% of the total bases in a dsDNA, the thymine content is 40%. A True B…
A: Charging rule states that the adenine and thymime would be equal and the cytosine and guanine would…
Q: Question 2 "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
A: Muttation is a phenomenon that occurs due to the alternation in the nitrogenous base pairs in the…
Q: Question 33 RNA polymerase II: A is located in the nucleoplasm and transcribes the protein-encoding…
A: Transcription is the process which is required for formation of mRNA from template strand of DNA.
Q: QUESTION 19 The role of primase at the replication fork is to... O A. decatenate (unknot) DNA B. O…
A: Replication is the process of making of daughter DNA from the parental DNA.
Q: QUESTION 29 In samples of DNA, isolated from two unidentified species of bacteria X and Y, adenine…
A: According to Chargaff's rule that the amount of purine should be equal to pyrimidine and also that…
Q: QUESTION 16 You are going to perform Next Generation sequencing on samples of RNA from cancer and…
A: The next generation sequencing is the advanced technology in field of determining the sequence of…
Q: Question 5. You are interpreting data on a DNA chip, or microarray. You expose the chip to a mixture…
A: A microarray is a collection of probes or oligos attached to a chip. Microarray is employed to…
Q: Question 11 In a molecule of double-stranded DNA, the amount of Adenine present is always equal to…
A: DNA is a double stranded helical structure comprised of several nucleotides joined end to end.…
Q: QUESTION 15 True or False: DNA is insoluble in ice-cold ethanol and precipitates or comes out of…
A: According to our policies, we are eligible to answer only one question. Hence, we will be answering…
Q: Question 93 Bonus: CRISPR-Cas 9 originally evolved as part of bacterial "immune response" against. O…
A: The CRISPR-Cas system is an immune system found in prokaryotes that provide resistance to foreign…
Q: QUESTION 14 The Hershey and Chase experiments, in which radioactive phosphorus (32P) and radioactive…
A: First question related to a experiment which is a confirmatory test of DNA as a genetic meterial.…
Q: QUESTION 15 The genome stze of humans and chimpanzees are both approximately 3 bilion base pairs,…
A: As per our guidelines, we are supposed to answer only one question. Kindly repost other questions as…
Q: QUESTION 14 The Hershey and Chase experiments, in which radioactive phosphorus (32P) and radioactive…
A: As per the guidelines we are supposed to answer only the first question in case of multiple…
Q: Question Completion Status: AMoving to another question will save this response. Question 35 If a…
A: DNA contains 4 nucleotides bases: Adenine Guanine Thymine Cytosine The Adenine binds with Thymine by…
Q: Question 17 The genetic code in unambigous that means many codons can code for the same amino acids.…
A: Answer : The genetic code in unambiguous that means that codons can code for the same amino acids .…
Q: Question 16 In base-excision repair, the first enzyme in the sequence is, _ creating a(n) _ site. (A…
A: INTRODUCTION Base excision repair This is a cellular mechanism that repairs damaged DNA.
Q: QUESTION 5 If DNA had 5 different bases, a restriction enzyme with a 3-base recognition sequence…
A:
Q: QUESTION 1: The 2x PCR Master mix (listed on p. 62+63) has four main components. Two of these are…
A:
Q: QUESTION 15 If there were 9 bases (letters) on DNA, how many amino acids would be linked together…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. DNA is the double-stranded…
Q: Question 14 Friedreich's ataxia is a rare inherited disease that causes nervous system damage and…
A: Friedreich ataxia is a genetic condition that affects the nervous system and causes movement…
Q: Question 29 DNA polymerases have an intrinsic 3' → 5' exonuclease activity with a proofreading…
A: (Note: According to the given guidelines, we are supposed to answer only one question. Please repost…
Q: QUESTION 23 The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded…
A: In DNA base pairing rule is that adenine (A) pairs with thymidine (T), and cytosine (C) pairs with…
Q: A transition mutation A. occurs when a purine is substituted for a pyrimidine or vice versa. B.…
A: Since there are multiple questions, we will be answering the first one for you. If you want answer…
Q: Question 10. You work for the FDA and need to test a new drug for mutagenicity before it can go on…
A: It is given that strain A has been single base mutate, whereas strain B is double frameshift…
Q: Question 27 the RNA polymerase binds at the promoter region Gene is switched ON Gene is switched OFF…
A: Gene expression is the transcription of a particular gene and production of RNA. The gene expression…
Q: Question 14 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…
A:
Q: In a double-stranded DNA molecule, how are the sequences of each strand related to each other? A…
A: DNA are the nucleotide which contains genetic information in our body and are found in nucleus.
Q: Question 7. What are the first three amino acids in the protein that is produced from this gene? -35…
A: mRNA is synthesized in the direction 5'-3'. The upper strand is called a template strand and the…
Q: QUESTION 36 DNA is tightly coiled around proteins (histones) that resemble a bead-like structure…
A: For the answer to the second part of the question, please post it separately. Thank you. DNA is a…
Q: Question 20 : The restriction map of the plasmid pSC48 is presented below. The numbers ir…
A: A restriction enzyme is a type of protein that recognizes a specific, short nucleotide sequence. It…
Q: Using complementary base pairing method, convert the following DNA sequence into RNA sequence. DNA:…
A: DNA is composed of two strands which are twisted in nature that surround each other to generate a…
Q: Question 44 Plasmids to become effective vectors and cloning really successful, they must be double…
A: Plasmids are Independent extrachromosomal DNA. These replicate independently of DNA hence it is used…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Question Number-1: Using complementary base pairing method, convert the following DNA sequence into RNA sequence. DNA: TACGGCGCGTATACGACTSequence wise otherwise vote.Question:- Viral vectors are not the only method being studied for gene therapy purposes. Which of the following is a nonviral delivery method for gene therapy? a.gene pills b.DNA bound to the surface of liposomes c.electrically stimulating cells to take up DNA d.DNA covered with protein
- Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCGQuestion. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:What is the Advantages and disadvantages of 24-hour recall
- Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…Question-1 During DNA replication, a.No errors occur b.only one strand of the molecule acts as a template c.Both strands of a molecule act as templates. d.The reaction is catalyzed by RNA polymeraseHelp with a sequence question
- QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.MCQ QUESTION: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base is targeted. A- Photoreactivation repair/ b- thymine SOS repair/ C-adenine Mismatch repair/ D- cytosine Proofreading/guanine The DNA sequence (5'-ATACAMA-3') was exposed to Ethyl Methanesulfonate (EMS) which is a(n) _______ . The resulting DNA sequence will become __________ after one round of cell division.QUESTION 27 Which of the following methods can be used to compare the amounts of one specific mRNA that is expressed by two different cell lines? A. Immunohistochemistry B. Western blotting C. Polymerase chain reaction (PCR) D. Immunocytochemistry