Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG

Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG

Case Studies In Health Information Management

3rd Edition

ISBN:9781337676908

Author:SCHNERING

Publisher:SCHNERING

Chapter3: Informatics, Analytics, And Data use

Section: Chapter Questions

Problem 3.37.1C

See similar textbooks

Similar questions

Which BLAST program should we use in this case? (HINT, what type of sequence are you provided with?)
How are the gap penalties adjusted in the ClustalW multiple sequence alignment program to improve the algorithm? Indicate the logic only.
You wish to align a 300 bp nucleotide sequence to a genome. Which of the following pairwise sequence alignment algorithms is BEST suited for this task? Global alignment or Local alignment? Please explain or elaborate why you chose this alignment algorithm.
What does BLAST stand for? Basic Local Alignment Search Tool Basic Local Alignment SequenceTool Best Local Alignment Search Tool Best Local Algorithm Search Tool
What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA) of conserved sequences at the DNA level versus the Amino Acid level? Please site references if possible and have 5+ sentences.
Which sequence variations are identified by NGS and in which format they are store Discuss in details the software used to identify the effect or nature of these variants. How this information can be used for personalized medicine.
Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATT
Why a multiple sequence alignment is needed for researchers? What inferences can be derived from this kind of sequence alignments? Explain two extreme cases that are non-informative for the multiple sequence alignment.
These are written as either accurate or contain errors. Rewrite each one with an error as an accurate statement. Please have an explanation. Thank you! An insertion mutation is not as severe as a transversion because the transversion changes the reading frame within the RNA. SINES, LINES and SNPs are three common types of repetitive sequences.
Can you help me solve this sequence question and identifty the mutation?
As a technique for detecting genetic variations, RFLP has substantial drawbacks. Name one such drawback, explain why it is unique to RFLP analysis with specific reference to the technique, and discuss why DNA sequencing overcomes this drawback. Please leave the link for any sources used. Thanks!
Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)