Question 40 Which of the following is not a key step in the activation of MRNA synthesis in eukaryotes? A Binding of other transcription factors. B Binding of TBP to the DNA. Phosphorylation of the RNA Pol. D Binding of RNA Pol I.
Q: Which of the following is true about HIV/AIDS? Group of answer choices All of these are true about…
A: HIV AIDS is most prevalent in the Africa (South >East) and it is fast spreading in western world.…
Q: Which of the following human cells produce insulin?
A: Insulin is a hormone which controls the blood sugar level in human beings. If insulin is not…
Q: Describe the steps of transcription in eukaryotes
A: Eukaryotic transcription is carried out in the nucleus of the cell by one of three RNA polymerases,…
Q: b) You are a contestant on the game show "Who wants to be a millionaire?". You must answer one final…
A: The part of nervous system that controls bodily functions which are not controlled voluntarily such…
Q: . If you observed a dicentric bridge at meiosis, what rearrangement would you predict had taken…
A: Introduction :- Only if there was at least one crossover in the inverted segment would a bridge…
Q: What is the World Health Organization recommendation for the prophylaxis of rheumatic fever after a…
A: Introduction - When strep throat or scarlet fever isn't treated appropriately, rheumatic fever might…
Q: Question 23 All may be RNA polymerase Il promoter constituents EXCEPT: A the core element where…
A: Transcription is the process by which RNA is produced from the DNA template. This process occurs…
Q: Q.2. Describe the individuals with the following chromosomal abnormalities: 1. Trisomy at chromosome…
A: 1) Trisomy - Trisomy results in Down's syndrome, which is an autosomal-linked genetic disorder that…
Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…
A: During DNA duplication, is the method to copy DNA stands when new cells are formed.
Q: Abacteria isolated from Yellowstone National Park is found to use the chemical methane as a food…
A: Chemotrophs are organisms whose energy source is obtained by the oxidation of inorganic…
Q: Q.1. Enumerate the post-transcriptional modifications in a eukaryotic mRNA.
A: The post transcriptional modifications :- 1 . Splicing : Here the introns are removed from the mRNA…
Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…
A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…
Q: What does a rabbit need that it makes for materials found in it’s environment
A: All living things have basic needs, same way the rabbit needs food, water and shelter to live in.
Q: Which one of the following is not associated with too much protein? A. reduction of lean body mass…
A: Proteins are biomolecules that are composed of a long chain of amino acids. They are important for…
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Q: Why are antibiotics not allowed in the treatment of rotaviruses?
A: Introduction - Rotavirus is a double-stranded RNA virus genus belonging to the Reoviridae family.…
Q: ) With the indication of sense strand, template strand, the direction of transcription, provide a…
A: the direction of the DNA template strand for transcription is Strand elongation DNA is…
Q: What are the immunological implications of 'bare lymphocyte syndrome' /MHC deficiency?
A: Introduction - Mutations in some genes of the major histocompatibility complex or genes involved in…
Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…
A: Hypocomplementaemia is the disease of the immune system in which the amount of the complement…
Q: Question 37 During bacterial RNA chain elongation, proceeds ahead of the transcription bubble…
A: The process by which RNA molecules are synthesized on a DNA template is called transcription.…
Q: Need help on questions 3 and 4, please. Drop-down answer choices are images. Canine Scott Syndrome…
A: 3. TMEM16F splice site mutation segregated with the CSS trait and TMEM16F protein was undetectable…
Q: Describe the structure of a glomeromycete fungus.
A: The given genera include Glomus, Acaulospora, and Gigaspora. The transfer of nutrients occurs…
Q: Which of the evolutionary processes discussed in the material presented can introduce genetic…
A: Natural selection: it states that only those organisms who are fit according to the environmental…
Q: Which of the following is not an example of homeostasis? Changing temperature Constant blood…
A: Homeostasis It is defined as the state of constant internal conditions( physical and chemical)…
Q: Discuss the scientific approach to human sexuality from a historical perspective.
A: Human sexuality is a term that defines an integral part of the personalities and way of expressing…
Q: Please could you explain how lymphocytes (especially B) can maintain receptors on their surfaces? Is…
A: Introduction A lymphocyte is a type of white blood cell found in most vertebrates' immune systems.…
Q: Rain falls on a fertilized agricultural field after a farmer has harvested the crop. Which…
A: Macronutrients of plants include Carbon, Nitrogen, Phosphorous along with the role of water. In…
Q: Having a widows peak is dominant W to not having one (ww) Having attached earlobes is a recessive…
A: Introduction Dominant traits are those phenotypic characteristics or properties which are inherited…
Q: Question 48 The energetic driving force for the synthesis of the new strand is the removal of the…
A: Removal of pyrophosphate group yields energy which is then diverted to the formation of new strands…
Q: The principal DNA polymerase in eukaryotic leading strand DNA replication is: A DNA polymerase B…
A: * DNA polymerase catalyze the synthesis of DNA molecules from precursors of DNA which are essential…
Q: Directions: Read and understand the situation very carefully. Hanabi, a grade 12 student have…
A: The examination of the evolutionary development and connections among or even within groups of…
Q: ructures commonly present in all vertebrate kidneys?
A: Vertebrates have the following variation of the kidneys: - Pronephros Mesonephros Metanephros
Q: . Why is Drosophila used extensively for genetic studies?
A: Drosophila is used extensively for genetic research because it possesses the following…
Q: 1. Which one of the following element (s) is / are contained in a protein (amino acid)? A. carbon B.…
A: Introduction Amino acids are molecules that combine to form proteins, When proteins are digested or…
Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT:
A: A promoter is a region of DNA where RNA polymerase begins to transcribe a gene.
Q: What is the Ro for a population with 300 susceptible individuals (S) at time zero, a transmission…
A: The estimated number of cases directly generated by one case in a community where all individuals…
Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…
A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…
Q: Two eukaryotic genes (A and B) are involved in two different metabolic pathways, and each has a…
A: Transcription elements are proteins that modify the transcription of genes, ie. Their copying into…
Q: Q.1. What causes adolescents to start using drugs? How can the use of drugs be avoided?
A: A few of the factors that lead to adolescents beginning to use drugs are as follows: Curiosity to…
Q: Explain why chytrids are considered an ancient fungal group.
A: Microscopic organisms are referred to as microorganisms. Bacteria, archaea, protozoa, algae, fungi,…
Q: Electrical impulses travelling from a point of origin to adjacent regions of the cortex is referred…
A: A sudden uncontrollable electrical disturbance on the brain is known as seizure. Causes change in…
Q: 2. Assume 250 base pairs to be responsible for a particular portion of mRNA molecule. What is the…
A: bp = base pair—one bp corresponds to approximately 3.4 Å of length along the strand 1angstrom (Å),…
Q: P. aurelia alone P. caudatum alone 300 08 70 250 200 150 - 40 30 100 20 50 - 10 10 15 20 10 15 20…
A: Resources are frequently restricted within a habitat, and numerous species may fight over them. Here…
Q: Which of the following statements about biotic potential is TRUE? Biotic potential of an organism…
A: Introduction Biotic potential:- It is the ability of a population of living species to increase…
Q: A student is building a model showing how living things are organized. Which pair of groups contains…
A: The highest number of organisms in a group can be found by the 8 level of classification system.
Q: energy flow differently in island pyramids vs landscape pyramids? Is the recycling of matter more…
A: The pyramid of energy depicts the flow of energy from one trophic level to another trophic level. It…
Q: In Figure 17-28, what would be the consequence of acrossover between the centromere and locus A?
A: The exchange of chromosomal segments between nonsister chromatids in meiosis is known as crossing…
Q: An advantage of gas exchange in water, compared with gas exchange in air is that water usually…
A: Gas change is the process by means of which oxygen and carbon dioxide flow among the bloodstream and…
Q: Which of the following regions on the tRNA are composed of a sequence of nucleotides? a. anticodon…
A: The tRNA is responsible for transferring amino acids at the site of translation or protein…
Q: In microscopy, what could be the possible reason why we cannot completely resolve the specimen under…
A: A microscope is a lab instrument used to examine the objects that are too small to be seen by the…
Step by step
Solved in 2 steps
- QUESTION 12 The leucine zipper domain of transcription factors is not involved in DNA recognition but rather in facilitating dimerization. Given the chemical properties of the amino acid leucine, dimerization of transcription factors via this domain by (select the correct option). Facilitating hydrogen bonding with the aqueous environment. Chelation of bivalent ions such as Zn2+. Formation of coiled-coils through hydrophobic non-covalent interactions between evenly spaced Leu residues in alpha-helical domains. Physically connecting the two transcription factor subunits through unstructured loops.Question 5. AP1 is a transcription factor and an important regulator of gene expression and cell proliferation. Dysregulation of AP1 function may lead to cancer. The fos gene codes for AP1. Below is an experiment in which the role of a micro‐RNA (miR‐7b) in the regulation of fos gene expression was studied. miR‐7b shows partial sequence complementarity to the 3′‐untranslated region of fos mRNA. A DNA fragment coding for miR‐7b RNA and another fragment coding for a micro‐RNA unrelated to fos mRNA were cloned into vectors, and the recombinant plasmids (designated si‐miR‐7b, samples 3 and 4, and si‐miR‐neg, samples 5 and 6, respectively, in Fig. 1) were introduced into mouse fibroblast cells. Non-transfected cells were used as controls (samples 1 and 2). Samples 2, 4, and 6, were treated with a chemical PMA that induces transcription of fos gene; samples 1, 3, and 5 were left untreated. Two hours after PMA treatment protein extracts were prepared from the cultures and were then…QUESTION NO. 1 Fragile X syndrome is a common form of inherited mental retardation. The mutation in the disease allows the increase of a CGG repeat in a particular gene from a normal of about 30 repeats to 200-1000 repeats. This repeat is normally found in the 5' untranslated region of a gene for the protein FMR1. FMR1 might be involved in the translation of brain-specific mRNAs during brain development. The consequence of the very large number of CGG repeats in the DNA is extensive methylation of the entire promoter region of the FMR1 gene. Methylation of bases in DNA usually A. facilitates the binding of transcription factors to the DNA. B. makes a difference in activity only if it occurs in an enhancer region. C. prevents chromatin from unwinding. D. inactivates DNA for transcription. E. results in increased production of the produce of whatever gene is methylated.QUESTION NO. 2 The best definition of an endonuclease is that it hydrolyzes A. nucleotide from…
- QUESTION 13 Where does transcription occur in eukaryotic cells? in the nucleus in the cytoplasm at the golgi apparatus at the plasma membraneQUESTION NO. 1 During initiation of protein synthesis, A. methionyl-tRNA appears at the A site of the 80S initiation complex. B. eIF3 and the 40S ribosomal subunit participate in forming a preinitiation complex . C. eIF2 is phosphorylated by GTP . D. the same methionyl-tRNA is used as is used during elongation . E. a complex of mRNA, 60S ribosomal subunit, and certain initiation factors is formed. QUESTION NO. 2 Normally, certain kinds of reiterated sequences occur in a chromosome as an interspersion pattern that is A. highly repetitive DNA sequences. B. the portion of DNA composed of single-copy DNA. C. Alu sequences. D. alcernacing blocks of single-copy DNA and moderately repetitive DNA. E. alternating blocks of short interspersed repeats and long interspersed repeats.QUESTION 23 Which of the following is not part of pre-mRNA processing in eukaryotes? Addition of a 5’ cap Excision of introns Addition of a 3’ poly-A tail Excision of the promoter
- question 26 What is true for CpG Islands: stretches of a few hundred base pairs of DNA where cytosines are unmethylated are not associated with genes are not found around the promoters are associated with silenced genesQuestion 29 A DNA sequence is transcribed in both males and females, but only translated in males. What type of sequence is this? A. 5’ UTR B. microRNA gene C. gene on X chromosome D. alternatively spliced exonQuestion: A gene can best be described as a segment of DNA that A. Transcribed B. Is transcribed as well as the associated regulatory regions C. Encoded for a protein or functional RNA D. Encoded for a protein C. Encoded for a protein as well as the associated regulatory regions Choose the Correct with explanation
- QUESTION 20 Which of the following is not true with respect to eukaryotic genes? They contain introns which do not code for protein They can exist as operons, with multiple genes under the control of a single promoter They require transcription factors for initiation of transcription Termination sites for transcription are not well definedQUESTION 10 Where does translation occur in eukaryotic cells? in the nucleus in the cytoplasm at the golgi apparatus at the plasma membraneQUESTION NO. 1 Much of procollagen formation occurs in the endoplasmic reticulum and Golgi apparatus which requires signal peptide. All of the following statements about targeting a protein for the ER are true except A. signal peptide usually has a positively charged N-terminus and a stretch of hydrophobic amino acids. B. signal peptide emerging from a free ribosome binds signal recognition particle (SRP). C. signal peptide is usually cleaved from the protein before the protein is inserted into the ER membrane. D. docking protein is actually an SRP receptor and serves to bind the SRP to the ER. E. SRP and docking protein do not enter the ER lumen but are recycledQUESTION NO. 2 All of the following statements about telomerase are correct except A. the RNA component acts as a template for the synthesis of a segment of DNA. B. it adds telomeric repeats to the 5'-ends of the DNA strands. C. it provides a mechanism for replicating the ends of linear…