QUESTION 5 Which of the following is (are) problematic when the goal is to construct phylogenies that accurately reflect evolutionary history? Oa. polyphyletic taxa and paraphyletic taxa O b. paraphyletic taxa Oc polyphyletic taxa O d. monophyletic taxa

QUESTION 5 Which of the following is (are) problematic when the goal is to construct phylogenies that accurately reflect evolutionary history? Oa. polyphyletic taxa and paraphyletic taxa O b. paraphyletic taxa Oc polyphyletic taxa O d. monophyletic taxa

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter27: Seedless Plants

Section: Chapter Questions

Problem 16TYU: Evaluate and Synthesize 16. EVOLUTION LINK Where would you position the rhyniophytes on Figure...

See similar textbooks

Related questions

Q: When two inbred plants with triangular pods were crossed, the Fi plants all had ovate The resulting…

A: This is definitely a cross in which an allele apart from the main allele also determines the pod…

Q: 2. Robert Koch was a German physician who identified the bacteria causing anthrax and tuberculosis.…

A: "Since you have posted multiple questions with multiple sub parts, we will provide the solution only…

Q: emitendinosus stylohyoid hypoglossus brachioradialis The hamstring that becomes tendinous midway…

A: Multiple muscles that are arranged into anatomical compartments constitute the upper limb. These…

Q: Tackle the question of how we determine membership in a particular species?

A: Definition A species is a group of organisms having similar features. A particular species has…

Q: Best techniques for the quick and reliable diagnosis of viral agents in sample and why that…

A: Viral agents can only multiply inside living cells and are nonliving outside of them. They have the…

Q: Which of the following structures would never be found in a eukaryotic cell? Cell wall Cell…

A: A cell was discovered by Robert Hooke in 1665. The cell is the basic structural and functional unit…

Q: Your research advisor would like you to measure the movement of a protein X using FRAP. The results…

A: FRAP is a technique that stands for fluorescence recovery after photobleaching. The technique is…

Q: The reaction below shows the energy changes in a chemical reaction. Reaction pathway What would…

A: Enzymes are biocatalysts that are responsible for speeding up a chemical reaction within (and also…

Q: Zygote Cleavage (Blastula) Cleavage (8-cell stage) Early Gastrula

A: The development of an organism begins after the fertilization process. Fertilization involves fusion…

Q: Which structure is highlighted? Multiple Choice O xiphoid process of the sternum body of the sternum…

A: The rib cage, a basket-like skeletal component that makes up the upper part of the body, or thorax,…

Q: What are three public health measures that could reduce the probability that bacteria will develop…

A: Antibiotic resistance has become a serious public health problem. Antibiotics are medications that…

Q: homodimers

A: Based on the oligomeric states of proteins, are classified as homodimers, homotrimers and…

Q: In squirrels, the gray allele (G) is dominant to the brown allele (g) at the coat color locus. A…

A: The principle is the genetic variation in a poulation will remain constant from one generation to…

Q: match the following mitosis terms with the following descriptions

A: Cell division is a tightly regulated multi-step process by which the cell splits into two daughter…

Q: Which of the following microscopy techniques can be used in live cell imaging in a live animal. 1.…

A: Live cell imaging within live animals is a vital facet of contemporary biological research, enabling…

Q: given a phage lysate with 10^11 pfu/ml and a bacterial culture with 10^8 cfu/ml, how would you…

A: phage lysate= 1011 pfu/mlbacterial culture= 108 cfu/mlMOI = 0.1You must combine the phage lysate as…

Q: Peripheral membrane proteins may noncovalently interact with phospholipid heads O contain many…

A: Peripheral membrane proteins display distinct features:Potential Noncovalent Interaction with…

Q: Cross Section of Earthworm

A: Earthworm is a terrestrial invertebrate organism that is found in soil. The phylum of earthworm is…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: Indicate which of the following are true about ribosomes. There may be more than one correct answer.…

A: The small, spherical, non-membranous cytoplasmic organel present in both prokaryote and eukaryotic…

Q: You discover a new bacterium. Its cell envelope shows high concentrations of phosphatidylethanolmine…

A: Bacterias are mainly classified in to two types in microbiology. They are:Gram-positive and…

Q: Analyze the following pedigree and determine the mode of inheritance. Assume that the traits being…

A: The correct answer is option D. Sex-linked recessive.

Q: Part II. Basic Body Plans Cross Section of Planaria Cross Section of Roundworm

A: A cross section or T. S also known as an axial plane is obtained by dividing the body into head and…

Q: evolution genetic variation Hardy-Weinberg equilibrium genetic drift adaptations sexual reproduction…

A: Evolution is the gradual process through which living organisms change over time, typically due to…

Q: See image

A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: Which of the following is true about the hedgehog family Hedgehog proteins are released from…

A: Hedgehog proteins are signaling molecules that play a crucial role in embryonic development. They…

Q: An organism has the chromosomes below where the letters represent genetic loci and the period…

A: Chromosome aberrations are modifications to the number or structure of chromosomes within the genome…

Q: 3. During the course of successful prenatal development, a human organism begins as a(n): A) Zygote…

A: The goal of developmental biology is to comprehend how an organism develops—how a single cell…

Q: ich of the following answer choice is incorrect abou the following statement, "While we know much…

A: Microorganisms are usually single celled or sometimes multicellular also. They are present in the…

Q: The allele for long eyelashes (t+) is dominant to short eyelashes. The allele for thick bones (r+)…

A: If two genes are located on the same chromosome then they are classified as linked genes. In this…

Q: Organelle Plasma Membrane Nucleus Mitochondria Smooth ER Rough ER Golgi Body Ribosome Lysosome…

A: The fundamental structural and operational unit of a living being is a cell. In accordance with the…

Q: A female Drosophila fly is heterozygous for three recessive pigmentation mutations called pl, bk,…

A: The scenario presented involves an exploration of genetics using Drosophila or fruit flies. In this…

Q: Which one of the following is not true about PEA medium? Select one: a. Contains sodium…

A: PEA medium is a specialized agar used in microbiology to isolate and grow Gram-positive bacteria…

Q: 2. The following is the sequence of a gene encoding a small protein: GG (d) 5'…

A: Chromosome is a thread-like elongated structure that contains numerous genes on it. Genes act as…

Q: Endothelial cells lining blood vessels can produce large amounts of nitric oxide (NO). The NO…

A: NO acts as a potent vasodilator in smooth muscle cells. It is synthesized and released by the…

Q: Which of the following correctly matches the stage of cellular respiration with its location within…

A: A key metabolic process called cellular respiration takes place in the cells of all living things,…

Q: In a strain of chickens, there are birds with white, black, or blue feathers. In crosses between…

A: Let's use the following alleles for feather color:W: White feathers (dominant)B: Blue feathers…

Q: Which of these viral proteins is capable of limiting cellular senescence and inducing malignant…

A: Viral proteins are proteins produced by viruses that play various roles in the viral life cycle.…

Q: O Increased ADH and increased aldosterone secretion O Increased ADH and decreased aldosterone…

A: ADH is also known as Vasopressin. It plays a crucial role in regulating water balance in the body.

Q: You are studying the role of cAMP in cell signaling. You hypothesize that 2 intracellular signaling…

A: The aim of the experiment is to keep track of the interactions that occur between the intracellular…

Q: The best definition for resolution is: O The ability of an organelle to pick up stain The thickness…

A: Resolution in microscopy is a critical concept because it determines the ability of a microscope to…

Q: Observational studies conducted in the 1980s and 1990s indicated that women in therapy hormone…

A: The reason behind the contradiction between observational studies and more recent experimental…

Q: 6 = W - 1 A 2 C ♦ ( ◆ ♦ N/A (> ◆ ◆

A: In a complementation chart a group will contain similar mutations that failed to compliment one…

Q: Label the anatomical parts of the root and shoot system of a plant. Place your cursor on the labels…

A: The study of the tissue and cellular makeup of plant organs is known as plant anatomy. When…

Q: An enthusiastic student, learning that proteasomes degrade proteins, suggests using a proteasome…

A: Proteosome : A proteasome is a protein complex that degrades other proteins that are damaged,…

Q: What is the relationship between an increase in fossil fuel consumption and increased carbon in…

A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…

Q: Identify the number of amino acids per 360o turn of an alpha helix. Given this information, how many…

A: Proteins are composed of higher folding of linear chain amino acids adjoined via peptide linkages.…

Q: f you breed fast box turtles and use midparent-midoffspring regression to determine that the…

A: In the world of breeding and genetics, the idea of heritability performs a critical position in…

Q: external lactose cell membrane on RNA polymerase promoter lactose permease B-galactosidase…

A: Genes that are connected to one another, such as those participating in the same metabolic process,…

Q: VITATI KEY: Positive charge: Purple, Negative Charge: Pink Hydrophilic: Green Hydrophobic: Brown…

A: In the study of proteins and amino acids, it is crucial to understand their interactions with their…

Concept explainers

Evolutionary lineages

An evolutionary lineage is a series of populations of organisms that descend from a common ancestor. Each species in the lineage is the direct consequence of evolutionary change from a common ancestor. A phylogenetic tree is generally used to display lineages visually. Lineages are components of the phylogenetic tree of life. Molecular systematics procedures are widely used to predict lineages.

Question

Give typed full explanation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Polyphylectic taxa

VIEW

Step 2: Paraphylectic taxa

VIEW

Step 3: Monophylectic taxa

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

QUESTION 22 Tiktaalik and Archaeopteryx are very important transitional forms. They provide evidence for evolution through examples of: a. microevolution b. macroevolution c. migration d. speciation
QUESTION 52 The most accurate phylogenies use… a. Analogous characteristics b. Evolutionary reversals c. Homologous characteristics d. Homoplastic characteristics
Question 3. The hypothesis thatexplains the origin of eukaryotic cellsas the result of two or more simplercells developing a relationship withone another is called:A. Theory of panspermia.B. Theory of symbiosis.C. Evolutionary theory.D. Theory of endosymbiosisE. Law of eukaryotic evolution.
QUESTION 9 Recent genetic research indicates that ____ or more individuals are needed for an endangered species to maintain its capacity for biological evolution. a. 100 b. 1,000 c. 10 d. 100,000 e. 10,000
QUESTION 82 Which technique did Charles Darwin use to measure the age of the Earth? A. rate of erosion of Igneous rocks in England B. rate of weathering of sandstone in sourthern England C. rate of erosion of the chalk formation in sourthern England D. rate of sedimentation of the oceans
QUESTION 8 Morphological differences are abundant among many species. We make assumptions about why adaptations exist, but to understand whether a specific trait is a adaptive and why, researchers must create experiments that have all the following, EXCEPT: a. replication of each treatment to ensure reliability of results. b. hypotheses that are testable and falsifiable. c. include control groups. d. exceedingly small sample sizes in each treatment group. e. experimental design that enables all full interpretation of differences.
Which statement about evolutionary trees is correct? Question 12 options: Branch length is always proportional to time Trees are always derived from morphological data For a given set of traits, a single tree is possible Trees represent hypothesized evolutionary relationships among taxa Only trees with straight limbs show evolutionary relationships
QUESTION 46 Which of the following statements about speciation is correct? a. Natural selection chooses the reproductive barriers for populations b. It always takes millions of years for speciation to occur c. The goal of natural selection is speciation d. Speciation is a process in which members become reproductively isolated into their own group.
Main question I need for notes: If evolution is true then why do new species seem to appear out of nowhere in the fossil record?Please answer the question below the picture if possible, thank you.
Question:- Why might some scientists use the morphological species concept or the ecological species concept instead of the biological species concept to define some species? Provide some examples in your reasoning.
Question A: From an evolutionary point of view, why can't we say that the human species is the most evolved? Briefly explain in your own words based on a concrete example
Evaluate and Synthesize 16. EVOLUTION LINK Where would you position the rhyniophytes on Figure 27-13? Would the line for rhyniophytes extend to the tips of the rest of the cladogram? Why or why not?