Question

Q: Toll-like receptors are proteins on _________ .a. phagocytes that recognize foreign moleculesb. viru...

A: The immune system provides defense against invading pathogens. It is a complex network of cells, org...

Q: Even though calcium is removed from troponin and tropomyosin, please describe in detail what else ne...

A: The events that result in the contraction of human muscle fiber starts with the signal by a neurotra...

Q: What is the purpose of an adjuvant?a. to kill the microbeb. to stop allergic reactionsc. to improve ...

A: Immunity can be defined as the capacity of the body of organisms to fight against harmful pathogens....

Q: Analyze your personality using the three determinants of personality. Discuss your answer .

A: Personality refers to individual differences in characteristic patterns of thinking, feeling and beh...

Q: Where does translation of mRNA into polypeptides occur? a.Cytoplasm b.Nucleus c.Nucle...

A: Cells are the biological, structural and functional unit of an organism. Cell has a nucleus that con...

Q: Eukaryotic cells are almost always larger than prokaryotic cells. What structures might allow for th...

A: The prokaryotic cells and the eukaryotic cells make up 2 of the 3 domains of life. The third domain ...

Q: What are the metabolism and its function?

A: Living organisms are open systems that maintain homeostasis, are composed of cells, have a life cycl...

Q: If a sequence of DNA has 20% Guanine bases how many Adenines would it have? Select one: O a. 10% O b...

A: If a sequence of DNA has 20% Guanine bases, then it would have 30% Adenine.   Hence, option (c) is t...

Q: How is photosynthesis similar in C4 plants and CAM plants?(A) In both cases, only photosystem I is u...

A: Photosynthesis is the process by which green plants fix CO2 into glucose. The process includes the l...

Q: Explain the meaning of fermentation from the standpoint ofbiotechnology.

A: The mechanism in which a substance breaks down into a simpler substance is fermentation. In the ferm...

Q: Discuss the locomotion of Rana?

A: Vertebrates have spinal cord which remain surrounded by bone or cartilage. Reptiles, birds, fish, am...

Q: An inversion heterozygote has the following inverted chromosome:What is the result if crossing over ...

A: Introduction Inversion: in this type of chromosomal abnormality there is usually two breaks happens ...

Q: Cancer is a disease related to uncontrolled cell division. Investigate two known causes for these ra...

A: Cancer develops when the body's normal control mechanism stops working. Old cells do not die and ins...

Q: How is the geneticdetermination of sexestablished in humans?

A: Sexual reproduction is a type of reproduction in which organism under goes different cycles like gam...

Q: The gene for a eukaryotic polypeptide 300 amino acid residues Iong is altered so that a signal seque...

A: Polypeptide is synthesized by using ribosomes attached on endoplasmic reticulum ( rough endoplasmic ...

Q: Some antibiotics target peptidoglycan synthesis. What is amolecular growth target of an antibiotic t...

A: Introduction Microorganisms are widely distributed and can be found in almost all kind of environmen...

Q: 2. What shapes result from secondary structure: a) β- helix & α-sheets b) α-helix and β-sheets...

A: Proteins are composed of amino acids that are joined together to form large polypeptide chains. The ...

Q: 22. Polymerization of nucleotides results in: a) polypeptides b) polynucleotides c) polysacchar...

A: BASIC INFORMATION  POLYMERISATION It is the process in which  many small molecules combine with each...

Q: Recognize behaviors or activities that would increase the risk ofcontracting Q fever.

A: Introduction: Q fever is also referred to as query fever and is an infection caused by bacteria Coxi...

Q: ectopic pregnancy, 6 weeks. what is the ICD 10 CODE. has to be 2 codes

A: ICD-10 is the 10th revision of the International Statistical Classification of Diseases and Related ...

Q: 25. All of the chemical reactions conducted by a specific organism: a) anabolism b) catabolism...

A: Biomolecules such as carbohydrates, lipids, proteins, vitamins, and minerals are essential to all li...

Q: In the early 1900s, Lucien Cuénot studied the genetic basis of yellow coat color in mice (). He carr...

A: Lucien Cuénot studied the genetic basis of coat color in mice. He carried out a number of crosses to...

Q: The richest source of vitamin D is:  A.  Cod liver oilB.  SpinachC.  MilkD.  Cheese

A: Vitamins carry out various functions in the human body. They are required for the metabolism of macr...

Q: Where are serocytes present?

A: Glands are significant organs situated all through the body. They produce and delivery substances th...

Q: State the correct sequence of plants in a hydrosere.

A: BASIC INFORMATION ECOLOGICAL SUCESSION the ecosystem is susceptible to change and is constantly doi...

Q: Current models for the origin of genetic information flow regard which of the following processes as...

A: The flow of genetic information from one organism to another involves two processes. Transcription a...

Q: "DNA is passed from one generation to another during cells division after DNA replication". which of...

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic info...

Q: During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer ...

A: DNA replication is the process of synthesis of new DNA molecules from the existing ones.    

Q: hat are the stages of Cellular Resplration? 1. 2. True or False: The energy for cells is ATP. Where ...

A: Cellular respiration is a complex process which occur in many stages inside the cell. Aerobic respir...

Q: Which of the following stimulates the production oferythrocytes?a. AMSb. high blood levels of carbon...

A: Blood is a specialized body fluid. Blood brings nutrients and oxygen to all the portions of the body...

Q: . A mature female wolf, with 78 diploid chromosomes in each somatic cell, produces haploid oocytes (...

A: Diploid consist of double set of chromosomes and haploid consist of half set of chromosomes.

Q: Match the informational signal in the left column with the appropriate category from the right colum...

A: Afferent fibers brings sensory information from peripheral receptors to central nervous system . Eff...

Q: It seems that developmental genetics boils down to a complex network of gene regulation. Try to draw...

A: The developmental genetics of Drosophila is a complex network of genes which are regulating the proc...

Q: Which DNA strand is complementary to this template strand: 5’-GACGCT-3’? 5’-AGCGTC-3’ 3’-AGCTAG-5’ ...

A: All living organisms store their genetic information in form of DNA / RNA. This genetic information ...

Q: . Rotavirus, a disease-causing member of the Reovirus family (with double-stranded RNA, but no DNA),...

A: Rotaviruses are members of Reoviridae family. They are nonenveloped particles. Rotaviruses causes di...

Q: In which bones can bonemarrow chiefly be found? Isthe bone marrow made ofosseous tissue?

A: A bone is a rigid organ and one of the hardest portions of the vertebrate skeleton. Various organs o...

Q: Give two examples of reflex action.

A: Reflex action A reflex action or simply reflex , is an involuntary response against a stimulus. This...

Q: A severe loss of blood may lead to what condition

A: Blood is the liquid connective tissue flowing in ghar.  It had a pigment named hemoglobin, which giv...

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 7. Are there homologs for the identified gene in other systems? Ident...

A: Hi! As you have posted multiple questions, I will be answering the first question for you. If you ne...

Photosynthesis

Plants have a capacity that we humans can only imagine— the ability to produce food from sunlight. Sure, we can prepare some dishes that we can savor on, but it become possible because of the plants (as they serve as a producers of all the raw materials required). Photosynthesis is the method of assembling carbohydrates with the aid of sunlight.