Rana frogs were morphologically similar, but based on their mitochondrial DNA sequences below, they are not the same. Rana palustris Rana pipiens Rana clamitans TTTTCA AGTAG AAGTGA A A AGCCTACCGAGCTTA TTTTCA AGTAG A AGTGA A AGCCTA CCGAGCTTA TTCTTAAGTAG AGGT АТАAGССТА ААСТТА Rana catesbiana TTCTTAAGTAGAGGTGATAAG CCTACCGAACTTA Rana sylvatica TTTTTA AGTAGAGGTGATAAGCCTA CGAACTTA Which of the following statements best supports the relationship and relatedness among Rana frog species? O By analyzing the fossil record alone, you could be able to devise a phylogeny about Rana frogs and other related common ancestors. Estimate the relatedness among organisms primarily by counting the number of differences in DNA sequences and the anatomy of their fossil ancestors. O Count the number of nucleotide sequences if a mutation occurred. O Rana frogs are unique to each other and there is no absolute significant relationship among this group of organisms.

Rana frogs were morphologically similar, but based on their mitochondrial DNA sequences below, they are not the same. Rana palustris Rana pipiens Rana clamitans TTTTCA AGTAG AAGTGA A A AGCCTACCGAGCTTA TTTTCA AGTAG A AGTGA A AGCCTA CCGAGCTTA TTCTTAAGTAG AGGT АТАAGССТА ААСТТА Rana catesbiana TTCTTAAGTAGAGGTGATAAG CCTACCGAACTTA Rana sylvatica TTTTTA AGTAGAGGTGATAAGCCTA CGAACTTA Which of the following statements best supports the relationship and relatedness among Rana frog species? O By analyzing the fossil record alone, you could be able to devise a phylogeny about Rana frogs and other related common ancestors. Estimate the relatedness among organisms primarily by counting the number of differences in DNA sequences and the anatomy of their fossil ancestors. O Count the number of nucleotide sequences if a mutation occurred. O Rana frogs are unique to each other and there is no absolute significant relationship among this group of organisms.

Name: 15 Rana frogs were morphologically similar, but based on their mitocho
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 15 Rana frogs were morphologically similar, but based on their mitochondrial DNA sequences below, they are not the same.Rana palustrisRana pipiensTTTCAAGTAGA AGTGAA A AGCC TCCGAGCTTATTTTCA AGTAGAAGTGA A A AGCCTСCGAG СТТАRana clamitansTCTTAAGTAGAGGTGA

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter32: Deuterostomes: Vertebrates And Their Closest Relatives

Section: Chapter Questions

Problem 1ITD: The phylogenetic tree for vertebrates depicted below was constructed from sequence data for two rRNA...

See similar textbooks

Similar questions

Please answer only A, B, C. I will repost this question for the rest. Include a brief explanation for each answer. Thank you very much :) The table below provides seven organisms differentiated with six simple characters (0 = absence, 1 = presence). For your convenience, a slanted cladogram of their relationship is also provided below the table. Identify which character is/are: A. Autapomorphic: B. Synapomorphic: C. Apomorphic: D. Pleisiomorphic: E. Autapomorphic for lynx and chimpanzee: F. Synapomorphic for lamprey and shark:
The Neanderthal nuclear genome: A. Shows that Neanderthals inherited their ability to flake stone directly from Homo habilis. B. Is overwhelmingly similar to the modern human genome. C. Demonstrates once and for all that Neanderthals had language. D. Is composed exclusively of mitochondrial DNA. E. Indicates that most Neanderthal females died young, which explains why Neanderthal populations were so small.
Can you please do both of the part to this question, part 1 filling the cart and part 2 drawing the Cladogram Part 1: Produce a character matrix for the fish. Note:Depending on how you define the fins on the ventral side of the fish you could have 9 characters or 10 characters - if you define it as a numerical character with states 0,1,2 you would have 9 characters total. If you define the fins as two separate binary characters ( a pelvic fin and an anal fin) you will have 10 characters. We recommend doing it as two separate characters: Anal fin (presence/absence) and pelvic fin (presence/absence). Character OG1 OG2 SpA SpB SpC SpD SpE Part 2: Construct the Cladogram for the fish using your Character matrix
In the past, the evolutionary history of whales was represented by cladogram A, shown below. As you can see, whales were believed to be closely related to mesonychids, an extinct group of mammals that looked similar to wolves. Today, that cladogram has been revised, as shown in cladogram B. Cladogram A Cladogram B Hippos Horses Hippos Whales Ruminants Pigs Camels Horses Mesonychids Time Time Which of the following statements best describes the reason for this change? Cladograms A and B are hypotheses that changed as new evidence became available. Cladogram B was revised to show a water-to-land pattern of evolution in groups of organisms. Cladogram B was altered to better include similarities in habitat as new information became available. Cladograms are organized today to show a much more simplified pattern like the one shown in cladogram B.
Only when extensive genetic data became available were scientists able to definitively resolve the relationship between humans, chimpanzees and gorillas. Explain why the relationship between these three species was a particularly difficult challenge to solve. Important point. Explain why the relationship between these three species was a particularly difficult challenge to solve??
In The Laboratory Exercise From Lab 7, Hylobates Is Chosen As The Outgroup. Why? a. The genus Hylobates morphologically resembles the genera Pongo and Sivapithecus. b. The genus Hylobates represents the derived condition for apes.
According to mitochondrial DNA Homo neanderthalensis and modern Homo sapiens diverged around____. a. 600,000 years ago b. 2.5 million years ago c. 150.000 years ago d. 35.000 years ago
A cladogram shows the evolutionary relationship between humans, chimpanzees, and gorillas. The cladogram currently shows humans and chimpanzees with a more recent common ancestor compared to gorillas. Which piece of evidence, if true, would most likely weaken this hypothesis? Amino acid analysis of the cytochrome shows significant differences in the sequence of amino acids between humans and goriffas. DNA sequence analysis of the hemoglobin alpha gene shows that humans and chimpanzees have a more similar sequence to each other than they do to the gorilla's DNA sequence. The cells of the eye in embryos of gorillas and humans follow a similar pattern of development chimpanzee embryos are different Fossils of humans appear in deeper sedimentary rock layers compared to fossils of chimpanzees.
What factors could be responsible for the size differences among modern vertebrate genomes?
Which is NOT an example of a structural homology? Please choose all applicable options. a) All vertebrate embryos form pharyngeal pouches.b) Vertebrate forelimbs generally have the same number and a similar arrangement of bones.c) The same group of embryonic cells forms the adult jaw of a perch and of a dog.d) All organisms share a common genetic code.
Hello, I need help answering 5c & 5d using the phylogeny below(letter (A) graph to the left). Pls and thank you! a) In the 1990s, when only mitochondrial DNA sequencing was available, geneticists claimed that there was no hybridization between humans (Homo sapiens) and Neanderthals (Homo neanderthalensis). Does the phylogeny shown above support the claim humans did not hybridize with Neanderthals in the past? How can you tell? b) Once nuclear DNA sequencing became fast and able to handle sequencing ancient DNA, living humans were found to have some Neanderthal genes. Is this finding clear evidence that some early modern humans did indeed hybridize with Neanderthals? Why? c) Did female H. sapiens hybridize with Neanderthal males to produce fertile offspring that then back-crossed with modern humans? What does the graph say about this? d) Did male H. sapiens hybridize with Neanderthal females that then back-crossed with modern humans? What does the graph say about this?…
Assuming chimpanzees (Pan troglodytes) and humans (Homo sapiens) are more closely related to each other than either is to gorillas (Gorilla gorilla), which of the following cladograms is correct? a. B b. A c. neither is correct d. both are correct