Answered: Q.17. Why are intergeneric crosses…

Name: Q.17. Why are intergeneric crosses almost unknown and interspecificcr
Uploaded: 2024-03-20T06:43:04.000Z
Channel: Bartleby
Description: Q.17. Why are intergeneric crosses almost unknown and interspecificcrosses rare in nature?

Science

Biology

Q.17. Why are intergeneric crosses almost unknown and interspecific crosses rare in nature?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter12: Mendel, Genes, And Inheritance

Section12.1: The Beginnings Of Genetics: Mendel’s Garden Peas

Problem 2SB: If, instead, the four phenotypes in question 1 occur in approximately equal numbers, what are the...

See similar textbooks

Related questions

Q: What is a stalemate, and how does it manifest itself? What is famine, and how does it manifest…

A: There are several terms used in the medical science with exciting features. There are number of…

Q: We are not usually consciously aware of our blood glucose levels because: O Information about blood…

A: * Nervous system divided into two main parts that is central nervous system (CNS) peripheral…

Q: The purpose of this research was not to test the functionality of the transplanted kidneys, but…

A: Kidneys are paired bean shaped organs. The remove excess water, toxins, wastes from the blood in…

Q: 1. What are the characteristic of the mating systems of rheas?

A: DISCLAIMER As per guidelines, you have asked multipart questions, so we will solve the first…

Q: false: in humans, genes make up more than 50% of the genome.

A: Most genomes, including the human genome and those of all other cellular life forms, are made of DNA

Q: Explain rna splicing in eukaryotes

A: The "translation" is the process through which mRNA codes for a certain protein. The ribosome…

Q: We are not usually consciously aware of our blood glucose levels because: O Information about blood…

A: Brain senses the changes in the blood glucose levels but the information is processed by the PNS and…

Q: Which statement is False? O B-D-glucose and B-D-galactose can be differentiated using NMR Epimers…

A: * NMR spectroscopy is used to study the physical and chemical and biological properties. *An NMR…

Q: Your uncle has tried every diet under the sun, yet he is still a very large man. He probably has…

A: When a person eats excess food and is not put into use then this food turns into fat reserve which…

Q: f you lost your ability to walk, could you access all of your house? What would need to change?…

A: Whenever one loses their ability to walk, they become wheelchair bound. Hence, their house, car…

Q: 1. What are advantages of nanotechnology in medicine and agriculture?

A: Introduction Nanotechnology:- It is the manipulation of materials on an molecular or atomic scale…

Q: A cross between plants having seed character RRY (round, green) and rrYY (wrinkled, yellow) will…

A: A Dihybrid cross is a cross between two individuals with two different traits. These two different…

Q: Match the different methods of analysis with the approaches in Glycomics Study of enzyme…

A: Glycomics is a subset of the field of glycobiology that aims to identify the structure and function…

Q: Please Give a clear explanation handwritten answer.

Q: The blood corpuscles are of, kinds. a) 5 b) 4 c) 2 d) 3

A: Introduction - Blood is a bodily fluid found in the circulatory system of humans and other animals…

Q: Compare the morphological characteristics of different roundworms Ascaris lumbriciodes…

A: Introduction Roundworms:- These are parasites that need to live in the body, it pose a significant…

Q: What is Pepsin

A: Digestion of food begins inside the mouth with the help of the enzyme salivary amylase and digestion…

Q: Question 1: You suspect that a patient has sepsis. A. What type of specimen would you collect to…

A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…

Q: Column A Column B Column C I. a. Spherical/globular A. Epithelial I. b. Striated, multinucleated,…

Q: FIGURE 10-3 Label this section of a finger with the appropriate terms on the lines provided and on…

A: Introduction The nail is made up of highly specialised epithelial cells and is platelike,…

Q: What is the role of the sulfuric acid in the Zak- Henley's method?

A: The serum is the blood plasma without the clotting factor. After sufficient coagulation, the serum…

Q: Question 13 Which of the following can determine location of glysosidic linkages? O Polarimetric…

A: LC-MS/MS-based method for the rapid and simultaneous relative quantitation of glycosidic linkages…

Q: a. The scale of a spectrophotometer extends from 1 to 100% T, what are the values of these two…

A: Ans a. Absorbance of these two extremes from percent transmittance ( %T) can be calculated by the…

Q: mitosis

Q: Cellular reprogramming and induced pluripotent stem cells have allowed scientists to model various…

A: Pluripotent stem cells have been used in the treatment of diseases and various other programs like…

Q: what suggestion do you have pertaining to the management of the diseases: a-KG dehydrogenase,…

A: Enzymes are essential components of all metabolic processes in the body. They are catalytic…

Q: Which of the following regions on the tRNA are composed of a sequence of nucleotides? a. anticodon…

A: The tRNA is responsible for transferring amino acids at the site of translation or protein…

Q: What are the parts of auricularis muscles and their specific functions? Tabulate the origin,…

A: The craniofacial muscles are a set of roughly 20 flat skeletal muscles that lie beneath the skin of…

Q: what is the relationship between genes and traits expressed in individuals? a) gene code for DNA,…

A: Every living organisms contain DNA as the genetic material. In case of eukaryotic cells the DNA is…

Q: Marcus is admitted to the hospital for a bone marrow stem cell transplant from his brother, What…

A: Introduction They are of various types of stem cells.Embryonic stem cells - They are isolated from…

Q: Matching: can have more than one answer 1. requires ATP A. diffusion random movement of molecules…

A: Introduction - Although cell migration necessitates energy, the metabolic cost of migration has yet…

Q: One of below statements are not correspond with dental caries * O Contagious disease b- Thick plaque…

A: Dental caries is a disease governed by various factors like the presence of fermentable sugar, the…

Q: Which of the evolutionary processes discussed in the material presented can introduce genetic…

A: Natural selection: it states that only those organisms who are fit according to the environmental…

Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: Which of the following is/are the contents of the dorsal body cavity? A. heart and lungs B. brain…

A: Introduction - The cranial cavity, which houses the brain, and the spinal cavity, which houses the…

Q: the questions about

A: Genotypes of parents: - XbXb:- mother:- Gametes:- Xb, Xb XBY:- father, Gametes:- XB, Y. F1:-…

Q: The describes the situation where the gene pool of a population is determined by the genetics of a…

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Mark has an autosomal recessive condition called sickle cell anemia, a serious blood disorder that…

A: Sickle cell anemia is an autosomal recessive disorder which ne it can only expression if present in…

Q: Question 37 During bacterial RNA chain elongation, proceeds ahead of the transcription bubble…

A: The process by which RNA molecules are synthesized on a DNA template is called transcription.…

Q: What is the other name given to sex chromosomes? What is the function of sex chromosomes?

A: Introduction - A sex chromosome is a chromosome that is different in shape, size, and behaviour from…

Q: 1. What is a casque? Which members of Casuariiformes have one, and what is though to be its…

Q: Can you determine the source of contamination (for example, human, domestic animal, or wild animal)…

A: Contaminants and contamination Contamination means the alteration in the original properties. Water…

Q: 4. Consider a fictional radioisotope X (311.1766 amu) a. If a 0,750 g sample of X-311 releases 5.75…

A: ANSWER;-

Q: Conservation of developmental genes in evolution is supported by all of the observations except that…

A: INTRODUCTION A homeotic gene is a collection of genes that manage the pattern of body formation…

Q: Why do we need the KANR gene next to the SPA tag sequence? Briefly explain how and why it is going…

A: * purification of affinity tagged proteins along with mass spectrometry is used as it allows for…

Q: 1. requires ATP A. diffusion 2. random movement of molecules from high to low B. facilitated…

A: Diffusion is the movement of molecules from a high region to a low-concentration area via random…

Q: Natural selection favored dark-colored fur in the rock pocket mouse. The selective force on the…

A: Natural selection It is a natural biological process where organisms adapt and change there…

Q: Q4.1. The image below shows a neuron's response to a medium-intensity stimulus. Which of the options…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Select the best description of permease activity in the following environmental conditions.

Q: In terms of an electrochemical gradient being produced, compare and contrast any three (3) systems…

A: *An electrochemical gradient is an gradient of electrochemical potential for ion which can move…

Concept explainers

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.

Topic Video

Question

Q.17. Why are intergeneric crosses almost unknown and interspecific
crosses rare in nature?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

How would you perform a reciprocal cross for the characteristic of stem height in the garden pea?
If, instead, the four phenotypes in question 1 occur in approximately equal numbers, what are the genotypes of the parents? What is this kind of cross called?
1. Show that the E-gene in turkeys is located on the Z-chromosome. Create two punnet squares ofreciprocal crosses as evidence.?
11. Shown below are the offspring of the testcross qr/q +r+ X q r/q r. Which groups are in the recombinant class? q+r and qr+ q+r+ and qr+ qr and qr+ q+r+ and qr
Which of the following situations does not follow the Law of Independent Assortment? A blond man and a brunette woman produce three offspring over time, all of who have blond hair A white cow crossed with a brown bull produces roan cattle Mating a hog with a sow produces six female piglets Men are more likely to experience hemophilia than women.
The gene for flower position in pea plants exists as axial or terminal alleles. Given that axial is dominant to terminal, list all of the possible F1 and F2 genotypes and phenotypes from a cross involving parents that are homozygous for each trait. Express genotypes with conventional genetic abbreviations.
11. what is The statistic used to calculate the likelihood of genetic linkage between genes ?
How often (copy number variation) CNV arises after MZ twinning ?
The phenotype of individuals heterozygous for ________ alleles comprises both homozygous phenotypes. a. epistatic b. codominant c. pleiotropic d. hybrid
3. What is the genotypic ratio of the test cross shown in Figure 4?
Explain how interference affects the number of doublecrossovers?
State the genetic consequences of reciprocal translocations ?