Reproduction is usually sexual with both male and female sexes, however asexual reproduction does exist with several unique adaptations. a) Discuss comprehensively the types of parthenogenesis and give an example of insect of each type.

Q: Given the challenges of human population, climate change, pollution and poverty. How would you…

A: The primary difficulties to economical advancement which are worldwide in character incorporate…

Q: 4. The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…

A: Alternative splicing of precursor mRNA is an essential mechanism to increase the complexity of gene…

Q: The following results were obtained from a disk diffusion test for microbial susceptibility to…

A: Zone of inhibition of an antibiotic shows its effectiveness. It is termed as the area or space where…

Q: 24. Which of the following species would ordinarily be at the highest risk of extinction? A. whales…

A: Extinction is a permanent termination of a particular species from the Earth. Extinct species never…

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: In bacteria, Which of the following mechanisms is the least probable in promoting antibiotic…

A: Antibiotic resistance  Antibiotic resistance bacteria are those which are able to survive in…

Q: What is the difference between REGULATORY VS SUBSTRATE DEPENDENT PATHWAYs. consider WT, single…

A: There are two types of paths available. Regulatory routes and assembly or metabolic processes have…

Q: ion ) parenchyma

A: Plant cells are photosynthetic eukaryotes. These belongs to the kingdom Plantae.

Q: How can the heart be strong enough to pump blood up your legs against gravity?

A: The heart is incapable of pumping blood back up the veins in your legs and back to your heart on its…

Q: Name 2 sources of variation produced during meiosis.

A: Meiosis is a form of cell division in which the  reduction of the number of chromosomes to half…

Q: 1.Transcription factors (TFs) bind to promoter sequences on DNA because the shape of DNA at that…

A: Transcription is a part of central dogma, in which the DNA molecule is converted into mRNA by…

Q: An inflammatory condition that affects the sac of synovial fluid outs the joint cavity would best be…

A: Osteoarthritis would be incorrect because it is age-related degeneration in the synovial joints…

Q: Choose the correct answer Q1: The forelimb of humans, dogs, birds, and whale are similar in the set…

A: 1) When a number of structures from organisms of different species have same basis structure like…

Q: Define 'oestrus' and 'menstrual cycles.

A: There are a few key ways that pregnancy and the menstrual cycle are related. First, both involve the…

Q: DNA polymerase delta has Pril subunit that can generate RNA primers True false

A: DNA polymerase alpha is the eukaryotic polymerase associated with primase activity.

Q: Subject: Biopharmaceutical technology 1.Identify the types of water that are available and widely…

A: USP (US Pharmacopeia) is a designation that ensures that the water is purified and can be used in…

Q: Please make a conclusion for this, thank you so much! :) An ear of corn has a total of 381 grains,…

A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is…

Q: The hemoglobin in mammalian blood is usually thought ofsimply as increasing the amount of O2 that…

A: Introduction :- Hemoglobin is a protein found in red blood cells that allows blood to transport…

Q: Which of the following are examples of analogous characters?  A. A chicken does not fly but an eagle…

A: INTRODUCTION:- ANALOGOUS ORGANS:- the organs which have similar functions but are…

Q: If GTP hydrolysis occurs on a tubulin molecule at the plus end of a microtubule filament before…

A: Tubulin makes up microtubules, which are the cytoskeleton's most important component.

Q: Q2: Which of the following statements is true about the protein Cytochrome C? A. Its secondary…

A: Phylogenetic trees are used to determine the relationship between the animals of the past and that…

Q: explain about the genetic drift   -differentiate founder effect from bottleneck effect.

A: Genetic drift or allelic drift is the change in the frequency of a gene variant in a population due…

Q: Explaina about pseudopregnant mouse ?

A: Pseudopregnancy consists of two words "pseudo" which means false and "pregnancy" which means…

Q: The fossil record (a) usually occurs in sedimentary rock (b) sometimes appears fragmentary (c) is…

A: All life on Earth descended from the universal last common ancestor, who lived between 3 and 4…

Q: The experiment uses a redox titration method to measure Vitamin C content in a tablet. Why you…

A: * Vitamin C  ascorbic acid is an antioxidant essential for humans this deficiency can lead to a…

Q: Are there any safety concerns with teaching a cat in this way?

A: Learning is defined as any relatively permanent change in behaviour that occurs as a result of…

Q: Ku proteins involve. nucleotide excision repair DNA repair before S phase single DNA strand break…

A: The Ku proteins bind to the ends of the linear phage DNA and stimulate LigD to ligate the ends to…

Q: 5. Describe a density-independent factor and explain why its effect on population growth is…

A: Food or nutrient shortages, environmental pollutants, and climate extremes, such as monsoons, are…

Q: 2. How can you help preserve the rich species diversity of the Philippines? 3. Why is it important…

A: Biodiversity means different types of life forms or species that exist on the earth. Human…

Q: The evolution of beak size in the various species of Galápagos finches is associated with their (a)…

A: Introduction:- The cumulative changes that occur in a population over time are referred to as…

Q: What is the common ground between evolutionary biologists and developmental biologists who have…

A: Evo-Devo is well stated that they are been sued as the abbreviation for evolutionary developmental…

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…

A: The answers attached below.

Q: Explain the process of genome editing ?

A: Introduction:- The genome is a cell's complete set of genetic instructions. The genome of humans is…

Q: 4. You are looking at a series of rock layers and you want to survey the youngest stratum. How will…

A: The goal of island biogeography is to study the climatic conditions which affect the flora and fauna…

Q: what structure prevents food from entering the windpipe?

A: The trachea is often called the windpipe. It's a key part of our respiratory system. When we breathe…

Q: 1. What is the function of DNA helicase in DNA replication? a. To create replication bubbles by…

A: Helicases are enzymes that catalyse the separation of duplex nucleic acids into single strands in an…

Q: explain the processes that occur during the act of defecation

A: Defecation is the final act of digestion, by which organisms eliminate solid, semisolid, or liquid…

Q: Which statement is NOT a key recommendation according to the current Dietary Guideline? Select one:…

A: Dietary guidelines provide advice on what to eat and drink for a healthy lifestyle. These help to…

Q: DNA gyrase manages DNA tangles and supercoils by breaking DNA strands to allowing DNA to rotate into…

A: Introduction:- During cell division, DNA replication is the process by which DNA duplicates itself.…

Q: Arthropod muscle fibers typically do not generate actionpotentials. Using your knowledge of their…

A: Introduction :- Most arthropods move by using their segmental appendages, and the exoskeleton and…

Q: Robert Koch’s impact on Microbiology?

A: Answer

Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…

A:

Q: Why is the epithelial tissue characterized as polar sheets? answer and explain

A: INTRODUCTION Tissues are the groups of cells that perform a particular or similar function in the…

Q: Dicuss a strategie for Diabetes in the UK.

A: Blood glucose is the main source of energy and it comes from the food we eat. Diabetes is a disease…

Q: what is the purpose of calcium ion in fertilization?

A: * Fertilisation is an generative fertilisation fusion of gametes gives rise to a new individual…

Q: Charles Darwin once said, “It is not the strongest of the species that survive, nor the most…

A: This is a misquote with special reference to Charles Darwin regarding The Origin of Species in 1859.…

Q: Make a simple schematic illustration of the connective tissue cell lineage descended from…

A: A cell is the smallest structural unit of an organism capable of autonomous functioning, consisting…

Q: What is a double-stranded DNA molecule ?

A: DNA also known as Deoxyribonucleic Acid is a macromolecule(Nucleic acid). It is found in the nucleus…

Q: Give 5 species under Agrobacterium tumefaciens.

A: Agrobacterium It is a rod shaped plant pathogenic soil bacteria having two strains. Genus of gram…

Q: For some traits, one allele is not completely dominant to another.  Incomplete dominance occurs when…

A: Incomplete dominant traits are those traits in which one allele is not completely dominant to…

Evolutionary adaptations

Evolutionary adaptation is the process through which organisms adapt or adjust to their surroundings to increase the chances of survival, mating, and reproduction. An organism's behavior, physiology, and structure are adjusted or changed to make it more suited to its environment.