explain the processes that occur during the act of defecation

Q: 5. Small interfering RNAS, microRNAS and Piwi-interacting RNAS are all classes of small RNA…

A: RNA can be defined as a nucleic acid present in all living cells. It is similar to DNA, but differs…

Q: Discuss the significance of the Hardy–Weinberg principle as it relates to evolution and list the…

A: In the absence of disrupting events, the Hardy-Weinberg equilibrium implies that genetic changes in…

Q: Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to…

A: Here I will provide you first 10 nucleotides long mRNA sequences according to question.

Q: Name the guidelines for naming of organisms?

A: There are numerous organism living on the surface of earth . Learning of these organisms is really…

Q: In a population at genetic equilibrium, the frequency of the dominant phenotype is 0.96. What are…

A: Introduction :- The condition of an allele or genotype in a gene pool (such as a population) in…

Q: Consider the following statements and indicate whether each presents an idea of Jean-Baptiste…

A: The evolution is the change in the characteristics of a species over several generations. It mainly…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: Which series is arranged in order from largest to smallest? Chromosomes, nucleus, cell, DNA,…

A: Introduction The cell is the smallest unit that can live on its own and that makes up all living…

Q: What did genera discussed the Staphylococcus? Are the healthcare concerns, infections, and…

A: the genus is divided into the two species Staphylococcus aureus and S. albus. Zopf (1885) placed the…

Q: Are the healthcare concerns, infections, and nosocomial infections discussed for genera…

A: Microbes, which are tiny and nearly invisible, have had a huge influence on society since the…

Q: Describe the six steps in antigen processing and presentation via the class II MHC pathway.

A: MHC II uses the exogenous pathway for antigen processing and presentation for antigen presentation.…

Q: Intermembrane space II IV 20000 00000 II NADH 1/2 02 Mitrochondrial inner membrane Matrix Figure 1.…

A: Cellular respiration is a metabolic phenomenon takes place inside the cell in which glucose is…

Q: -In humans, the ability to roll the tongue is a dominant trait. If a man is homozygous dominant for…

A: 1. In humans, the ability to roll the tongue is a dominant trait. If a man is homozygous dominant…

Q: Identify one Filipino scientist, Research on his contributions in the field of science, make a brief…

A: A biologist is a scientist who does biological study. Whether that's a single cell, a multicellular…

Q: What is Biological classification? What is the need of classification?

A: The naming of organisms by two words is referred to as biological classification. One is a generic…

Q: schema __ illustrates simple segragation. shema__illustrates how interpersion is violated during…

A: * Different designs of tank arrays modified and redrawn from ocean acidification . * Different…

Q: In practice, what are the component parts of a GPC system and how they work together?

A: One of the most effective and diverse analysis tools for evaluating and forecasting polymer…

Q: When does DNA replication occu after the cell divides O before protein synthesis O during cell…

A: Cell cycle is the series of cell division that takes place in a cell as it grows and divides. Cell…

Q: What is single molecule sequencing in real time (SMRT) ?

A: DNA sequencing is a technique for determining the order of the four nucleotide bases found in DNA:…

Q: In _______________ the selecting agent is the environment, whereas in _______________ the selecting…

A: Introduction Natural selection is the adaptation and modification of populations of living…

Q: Describe a synaptic mechanism underlying the formation of memory.

A: Synaptic transmission allows neurons to interact with any type of cell that expresses receptors for…

Q: Explain how the three forms of adult muscle have various potentials for regeneration after injury.

A: Cell organelles are the building blocks of a cell. They are useful for conducting various cell…

Q: 9. a. What fossil primate possesses traits of both anthropoids and hominoids? b. What are those…

A: Hominid is a sort of primate that has a place with the family Hominidae. In scientific…

Q: The pedigree below shows the inheritance pattern of a rare X-linked allele for one family. The…

A: Pedigree is a family chart where genetic councillor put some symbol for easy description of a…

Q: Table I. PHENOTYPE/GENOTYPE DETERMINATION TRAIT YOUR PHENOTYPE YOUR GENOTYPE(S) Darwin's Ear Point…

A:

Q: Why is mutation important to evolution if it is the microevolutionary force t

A: Mutation is the process in which the DNA sequences are changed due to misplaced entries, deletion or…

Q: How do eukaryotic and prokaryotic RNA polymerases compare? Despite their added complexity,…

A: RNA polymerase is an enzyme which is responsible for the transcription process, that takes place in…

Q: Provde real exmaples of Public health strategies and campains of the prevalence of diabetes.

A: Diabetes can be described as condition in which blood glucose or blood sugar, becomes too high in…

Q: a. How many generations are presented in this pedigree? b. What are the most probable genotype of…

A: Pedigree It is a diagrammatical representation of the inheritance of a trait over several…

Q: A critique is a genre of academic writing that briefly summarizes and critically evaluates a work or…

A: Critique analysis is evaluation of text, it is subjective writing. The purpose of critique is to…

Q: process of eukaryotic transcription in detail and mention the specific enzyme

A: Transcription can be defined as the process of copying genetic information from one strand of the…

Q: The buzzing of the alarm clock woke Halie. She stretched, yawned, and started to salivate as she…

A: The human nervous system is a "complex network" that includes the brain, nerves, and spinal cord and…

Q: A two-month-old baby is found to lack class I MHC molecules. How would this defect impact his…

A: A large locus present on vertebrate DNA known as the Major Histocompatibility Complex (MHC), has a…

Q: Explain comprehensively how the ganglia originated embryologically? How do these affect the role…

A: The "nervous system", also known as the neural system, is a complicated network of neurons that are…

Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…

A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…

Q: Describe ONE likely mechanism of action of a caspase inhibitor. Explain why an inhibitor for…

A: Caspases are expressed inside cells as inactive precursors that must be activated in order to cleave…

Q: Name the cells which are : (i) double negative T cells (ii) double positive T cells

A: T cells are a part of immune system and develop from stem cells in the bone marrow. They protect the…

Q: 1.Find the ear of corn marked Dihybrid Testcross. This ear represents the offspring of the cross…

A: NOTE- since you have posted multiple questions so we will be solving the first question for you. If…

Q: Explain the sequencing-by synthesis (SBS) approach ?

A: One of the well-known states that are known as fundamental topics in Arithmetic is sequence and…

Q: What would happen to a polarized epithelial cell tissue if we added a calcium chelating agent…

A: Answer : if we assume calcium chelating agent externally to a polarized epithelial cell tissue then…

Q: reduction potential

A:

Q: 1. You are observing an unknown vertebrate whose limbs are probably vestigial. What are the possible…

A: A limb is a jointed appendage in humans and numerous different animals use for locomotion like…

Q: What is the basic principle of GPC (gel permeation chromatography)?

A: Gel permeation chromatography is a type of size-exclusion chromatography that uses organic solvents…

Q: Explain "Numerical taxonomy" briefly.

A: Introduction In this question we will explain the Numerical taxonomy.

Q: What is the role of dynamin in recycling synaptic vesicles? What evidence supports this?

A: GTP bonding protein, also referred to as G protein. G protein is found in eukaryotic cells and is…

Q: Transcription occurs along a_template forming an MRNA in the _direction. * O none of the above O 5'…

A: The central dogma explain how the DNA codes for the proteins which proceed in three stages namely…

Q: The fossil record (a) usually occurs in sedimentary rock (b) sometimes appears fragmentary (c) is…

A: All life on Earth descended from the universal last common ancestor, who lived between 3 and 4…

Q: Turnover of RNA and protein helps to control gene expression by influencing the concentration of…

A: Gene expression is a process in which the genetic instructions of genes are utilized to manage…

Q: Summarrize the laws and policies that relate to the practice of agricultural and biosystems…

A: It was An Act Strengthening, Modernizing and Aligning the Practice of Agricultural Engineering in…