Answered: S ..GACTAAGGCTTAGS CTGATieCGAATGS…

Science

Biochemistry

S ..GACTAAGGCTTAGS CTGATieCGAATGS .CTGATTCCG AA TG 5 NEW STRANDS (Fill in the correct bases and supply arrowheads.)

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 3CT: The results of a paternity test using short tandem repeats are listed in the table below. Whos the...

See similar textbooks

Related questions

Q: Describe the discontinuous synthesis of the lagging strand in DNA replication.

A: During the process of replication of DNA, each of the parental DNA strands is used as a template.

Q: Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary…

A: DNA or DeoxyRiboNucleic Acid is a biomolecule which serves as a genetic material in number of…

Q: Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) origin of…

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: and these protect the strands and prevent the separated DNA strands from reannealling at Single…

A: DNA replication is the process by which a molecule of DNA is duplicated. In this, a dsDNA molecule…

Q: A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Unzipped Single Strand of DNA Complementary Strand of DNA Build the complementary strand of DNA to…

A: A nucleotide is the basic building block of nucleic acids. Ribonucleic acid (RNA) and…

Q: In DNA replication, there are leading and lagging strands because A) DNA replication is…

A: DNA replication is the process by which the genetic material of the cell is doubled which is then…

Q: Evaluating: If a DNA strand reads AATGCTCCAGT, what would the complementary strand read: * O…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: Explain in details the conservative replication of DNA and the dispersive replication of DNA

A: DNA replication is a process that takes place in every biological cell. It involves coping and…

Q: the semi-conservative DNA replication

A: DNA replication is a process that involves the formation of identical copies of DNA from the…

Q: DNA replication reaults in two daughter double hellces, each containing one atrand from the original…

A: DNA replication The production of new double stranded DNA from old one is known as DNA replication.…

Q: DNA replication AND repair both finish with the action of Primase DNA polymerase l DNA polymerase II…

A: Primase- Primase is an enzyme that produces primers, which are short RNA sequences. Primase works by…

Q: Describe the roles of helicase and topoisomerase in DNA replication

A: DNA replication is the process of copying the single DNA strand into two identical copies. It…

Q: Explain the synthesis of the leading and lagging strands during DNA replication and identify the…

A: The enzyme DNA polymerase with an RNA primer can synthesize new strands in the 5' to 3' direction.…

Q: Determine the complementary strand of DNA that forms on this template DNA fragment during…

A: The complementary strand of the DNA fragment during the replication : 3' CCAAAGAAGTTCTCT 5'

Q: In the lagging strand, DNA is made in the direction _________ the replication fork and is made as…

A: The DNA replication is the process by which the genetic material of the organism copies itself to be…

Q: What is the importance of DNA replication to DNA’s function of storing genetic information?

A: The process of replication of DNA forms the basis of the inheritance of genetic information that…

Q: What is needed for DNA replication to take place? Explain using a figure which illustrates there…

A: DNA replication is a process of producing two identical DNA replica similar to the parent DNA.

Q: copy of a molecule of DNA. In this process, the joining of nucleotides to extend a new strand of DNA…

A: DNA replication is a process in which DNA makes its daughter stand by making a copy of the original…

Q: The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat…

A: WT replication without slippage:

Q: DNA gyrase helps replication by reducing the stress caused by the unwinding DNA. breaking the H…

A: DNA replication A process by which new DNA is made which is exact copy of the previous DNA.

Q: ) How is the lagging strand made in DNA replication? Include important enzymes and structures.…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: explain the feature of DNA replication and how this replication is considered accurate

A: DNA replication is the interaction by which a double stranded DNA molecule is duplicated to create…

Q: describe the function of Helicase, and DNA Polymerase in the DNA replication process.

A: DNA helicases are fundamental during DNA replication since they separate double stranded DNA into…

Q: Explain the complexities of DNA replication that make the process (a) bidirectional and (b)…

A: DNA is a molecule made up of a chain of identical five-carbon sugars (polymers) that are linked…

Q: Describe the DNA replication process, including its initiation and the events that occur at the…

A: Watson and Crick discovered that DNA was a two-stranded double helix which provided an idea of how…

Q: DNA polymerase separates the two strands of the relaxed DNA helix; the point of separation is the…

A: a. DNA replication is the biological process of producing two similar copies of DNA from one…

Q: Replication _______________ form as the replication forks spread our in opposite directions.

A: Replication bubble forms as replication fork spreads out in opposite direction.

Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…

A: Complementary DNA Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…

Q: I'm struggling with understanding DNA replication, more specifically transcription and translation…

A: DNA replication is asymmetrical because one new strand is synthesized continuously, called as the…

Q: DNA Replication For the following piece of DNA, draw the replicated piece of DNA the original and…

A: DNA replication is a process by which one molecule of DNA replicates and results in two daughter DNA…

Q: Define DNA replication/synthesis and semiconservative replication. In addition, describe and/or…

A: DNA replication is a very important process in the life cycle of a cell. It is required for the cell…

Q: What are the steps in the replication

A: DNA REPLICATION This is a complex process takes place during the cell division, whereas dna makes…

Q: Explain semi-conservative modelmof DNA replication b) discuss initiation in DNA replication and…

A: DNA replication is the process in which the copies of DNA is made by the action of several enzymes…

Q: How does the model attached show DNA Replication? What is the importance of DNA Replication? What…

A: DNA act as a very important genetic molecule in living organisms.DNA replication is the biological…

Q: Give the full form of DNA.

A: Nucleic acid belongs to the category of the biomolecules. These nucleic acids are basically made up…

Q: List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a…

A: DNA (deoxyribonucleic acid) is the genetic material of almost all living organisms. It is a double…

Q: During DNA replication, half of the strand is conserved in the new molecules cteated. This is called…

A: Formation of new DNA from the old DNA is known as DNA replication. DNA replication occurs within the…

Q: Which of the following statements are true about DNA polymerase? Select all that apply. O On the…

A: Polymerases are enzymes that catalyze the synthesis of DNA or RNA polymerase whose sequence is…

Q: Complete the complementary stand of the DNA shown Complementary strand стАG GTAC TCAC G

A: It is the DNA strand in which the sequence if the constituent molecules on one strand matches the…

Q: t the following steps of DNA replication in order. Each new double strand of DNA winds into a double…

A: DNA ( Deoxyribonucleic acid ) replication is a process of making DNA from a template strand of the…

Q: Compare DNA replication on the leading and lagging strands, including both similarities and…

A: Leading strand is the parent strand of DNA which runs in the 3’ to 5’ direction towards the fork and…

Q: Explain why errors in DNA Replication are rare events in cells?

A: Introduction :- DNA ( Deoxy-ribonucleic acid) acts as the genetic material of the cell ( Present…

Q: At which point during DNA replication is genetic lost from the telomeres? Enzymatic action of…

A: Replication is the process of making two identical DNA molecules from a double-stranded DNA…

Question

Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new strands. Put an arrowhead in the appropriate end of each new strand to illustrate the direction of growth.

3'. . CTGATTCCGAATG 5
.GACTAAGGCTTAG
CTGATTCCGAATGS
NEW STRANDS
(Fill in the correct bases
and supply arrowheads.)

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: DNA replication

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

the DNA consists f 2 strnds hold together by which bond?
The first and major effect in denaturation of proteins is that: a. peptide bonds break. b. helices unwind. c. sheet structures unfold. d. tertiary structure is changed. e. quaternary structures disassemble.
The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
DNA replication requires _______. a. DNA polymerase b. nucleotides c. primers d. all are required
9. Describe the importance of DNA in determining the structure of a particular protein.
5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)
1. For this oligonucleotide, Classify if RNA or DNA? Justify your choice. determine the sequence of this segment, labeling the 5′ and 3′ ends.
1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-
1. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. ATG GCA TGC AAT AGC TCA TGC 2. What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A?
3. Explain how water activity and pH can affect the susceptibility of proteins to denaturation by heat.
8 What are the three components of anucleotide?
1- Why do we heat the proteins before we load them on the gel? What does beta-mercaptoethanol do to protein structure?