Skip to main content
Question

Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary template strand of DNA that pairs with the coding strand?

Expert Solution

Want to see the full answer?

Check out a sample Q&A here
Blurred answer
Students who’ve seen this question also like:
Concepts of Biology
Concepts of Biology
1st Edition
ISBN: 9781938168116
Author: Samantha Fowler, Rebecca Roush, James Wise
Publisher: OpenStax College
Not helpful? See similar books
Concepts of Biology
Concepts of Biology
Molecular Biology. 13CTQ
Similar questions
To this solution
Learn more about
Nucleic Acids
marketing sidebar icon
Want to see this answer and more?
Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*
*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: If the sequence of one strand of DNA is written as follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write…

A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction…

A: ••Complimentary strand of DNA is made by by process of Replication Replication is process in which…

Q: What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…

Q: What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'

A: A nucleic acid sequence is a set of five letters that indicates the order of nucleotides in a DNA or…

Q: Give the DNA compliment to the following DNA strand. ATG UAC b. TAC GTG OMG

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: one strand of DNA has the sequence 5'-CGGA-3'. What is the sequence of the complementary strand ?

A: Answer: DNA : Deoxyribonucleic Acid is the genetic material present in organisms and species which…

Q: DNA Structure On the diagram: Label the 3' and 5' ends. G Circle a nucleotide Label the sugar and…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. If you need help with other sub…

Q: Give the DNA compliment to the following DNA strand. ATG UAC TAC GTG P. OMG

A: cDNA is a form of DNA in which the base sequence is identical to that of a specific piece of DNA.

Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT

A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…

Q: Normal Strand: DNA: GCA ATG CAC MRNA: Amino Acids:

A: A frameshift mutation is a genetic mutation. It is caused by indels of the number of nucleotides in…

Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…

A: The answer is TTTAGCC. The last option.

Q: copy of a molecule of DNA. In this process, the joining of nucleotides to extend a new strand of DNA…

A: DNA replication is a process in which DNA makes its daughter stand by making a copy of the original…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…

Q: Ulla Unigriffin DNA: | CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | MRNA: amino acids:

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Complementary strand for A T C and G

A: There are two types of nucleotide bases in DNA -  Purines - A(Adenine) and G(Guanine) Pyrimidines -…

Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…

A: The central dogma of molecular biology is the metabolic process in which the double-helical…

Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…

A: Complementary strands are two chains of DNA that make up the double-helical structure of DNA. The…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'

A: DNA strands are boned together with the help of hydrogen bonds present between the base pairs. These…

Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE

A: Above table is codon anti-codon table for translation of DNA code into protein sequence.

Q: Joining two DNA molecules using DNA ligase. Ligation. O Adhesion. Linker Linkage.

A: DNA fragment is joined with another DNA fragment by the formation of phosphodiester bond. Enzyme…

Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…

A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…

Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of RNA making sure its…

A: DNA unlike RNA is a double-stranded molecule. In molecular biology, the genetic information in DNA…

Q: Complete the complementary stand of the DNA shown Complementary strand стАG GTAC TCAC G

A: It is the DNA strand in which the sequence if the constituent molecules on one strand matches the…

Q: Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3

A: Dna transcription is the process in which the dna makes mrna copies using the enzyme called rna…

Q: Match the correct bases pairs to find the opposite strand of DNA strand of       DNA -  T  G  C…

A: DNA is deoxyribonucleic acid. It is the genetic material which is double stranded, which means it…

Q: In a sample solution given to be analyzed; CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and…

A: DNA or deoxyribonucleotide chain is a double helical structure, containing nucleotide monomers,…

Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…

A: Click to see the answer

Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…

A: DNA molecule is a polymer of nucleotides and each nucleotide has three main components that are…

Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of DNA, making sure its…

A: According to the question, we have to give a complementary strand of DNA for the following DNA…

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: Answer: Central Dogma : It is the complete process of replication of DNA,  transcription of DNA to…

Q: If a codon on DNA section is A-G-T.4 * ?fınd an anti codon on tRNA

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…

A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…

Q: One strand of a DNA molecule contains the base sequence 5'-ACTTGCCA-3'. Write its complementary base…

A: Two strands of DNA both are antiparallel and complementary to each other.

Q: . Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: The central dogma of molecular biology describes the flow of genetic information in the cell from…

Q: A strand of DNA has the sequence 5'-AGTC-3'. What is the sequence of the complementary strand in the…

A: The DNA has two strands which are comprised of nucleotides- A stands for adenine, T stands for the…

Q: One strand of a DNA molecule has the base sequence CCATTG. What is the base sequence for the…

A: Chargaff’s rule of DNA base pairing: Chargaff’s rule states that number of purines and pyrimidines…

Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…

A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…

Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…

A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…

Q: G. C. C. ". 1. DNA Complement: 2. RNA strand: Complete the structure by labelling the bonds and…

A: DNA complement : It is a DNA copy of messenger RNA molecule produced by reverse transcriptase , a…

Q: polynucleotide strand has the bases G, T, C, and T, starting from the 5’ end. Assuming this is a DNA…

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid.  It is the genetic material of all…

Q: A strand of DNA has the specific sequence ATGGCTA. What would be the sequence of a complimentary…

A: Click to see the answer

Q: Transcribe the following DNA strand into a mRNA strand. TAC

A: During transcription the information in the Strand of DNA is copied into mRNA template strand.

Q: A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: A.  1. Create the complementary strand for the DNA strand below. Make sure to label the parts and…

Q: DNA G C strand DNA TAC TA C strand MRNA A UG U G codon TRNA anticod on Amino Tryptoph Stop acid an…

A: DNA replication via process of formation of DNA strand using DNA itself acting as a template. DNA…

Q: . The table opposite shows the standard (coding strand) DNA inlet codes for the 20 amino acids…

A: Given , the  coding strand is     5'-CATCCAAATTGTTGCCCG-3' THE TEMPLATE STRAND WILL BE ,…

Q: Build a plypeptide DNA: TAC-TCC-CGG-GTT-ACC-ACT

A: DNA is the genetic material of the organisms like humans. The DNA is transcribed into the RNA by the…

Q: Give the full form of DNA.

A: Nucleic acid belongs to the category of the biomolecules. These nucleic acids are basically made up…

Knowledge Booster
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
    Recommended textbooks for you
  • Concepts of Biology
    Biology
    ISBN:9781938168116
    Author:Samantha Fowler, Rebecca Roush, James Wise
    Publisher:OpenStax College
    BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
    Biology
    ISBN:9781305967359
    Author:STARR
    Publisher:CENGAGE L
    Biology (MindTap Course List)
    Biology
    ISBN:9781337392938
    Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
    Publisher:Cengage Learning
  • Biology Today and Tomorrow without Physiology (Mi...
    Biology
    ISBN:9781305117396
    Author:Cecie Starr, Christine Evers, Lisa Starr
    Publisher:Cengage Learning
    Human Heredity: Principles and Issues (MindTap Co...
    Biology
    ISBN:9781305251052
    Author:Michael Cummings
    Publisher:Cengage Learning
    Biology: The Dynamic Science (MindTap Course List)
    Biology
    ISBN:9781305389892
    Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
    Publisher:Cengage Learning
  • Concepts of Biology
    Biology
    ISBN:9781938168116
    Author:Samantha Fowler, Rebecca Roush, James Wise
    Publisher:OpenStax College
    BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
    Biology
    ISBN:9781305967359
    Author:STARR
    Publisher:CENGAGE L
    Biology (MindTap Course List)
    Biology
    ISBN:9781337392938
    Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
    Publisher:Cengage Learning
    Biology Today and Tomorrow without Physiology (Mi...
    Biology
    ISBN:9781305117396
    Author:Cecie Starr, Christine Evers, Lisa Starr
    Publisher:Cengage Learning
    Human Heredity: Principles and Issues (MindTap Co...
    Biology
    ISBN:9781305251052
    Author:Michael Cummings
    Publisher:Cengage Learning
    Biology: The Dynamic Science (MindTap Course List)
    Biology
    ISBN:9781305389892
    Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
    Publisher:Cengage Learning