Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary template strand of DNA that pairs with the coding strand?
Find answers to questions asked by students like you.
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…
Q: If the sequence of one strand of DNA is written as follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction…
A: ••Complimentary strand of DNA is made by by process of Replication Replication is process in which…
Q: What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…
Q: What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'
A: A nucleic acid sequence is a set of five letters that indicates the order of nucleotides in a DNA or…
Q: Give the DNA compliment to the following DNA strand. ATG UAC b. TAC GTG OMG
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…
Q: one strand of DNA has the sequence 5'-CGGA-3'. What is the sequence of the complementary strand ?
A: Answer: DNA : Deoxyribonucleic Acid is the genetic material present in organisms and species which…
Q: DNA Structure On the diagram: Label the 3' and 5' ends. G Circle a nucleotide Label the sugar and…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. If you need help with other sub…
Q: Give the DNA compliment to the following DNA strand. ATG UAC TAC GTG P. OMG
A: cDNA is a form of DNA in which the base sequence is identical to that of a specific piece of DNA.
Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…
Q: Normal Strand: DNA: GCA ATG CAC MRNA: Amino Acids:
A: A frameshift mutation is a genetic mutation. It is caused by indels of the number of nucleotides in…
Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…
A: The answer is TTTAGCC. The last option.
Q: copy of a molecule of DNA. In this process, the joining of nucleotides to extend a new strand of DNA…
A: DNA replication is a process in which DNA makes its daughter stand by making a copy of the original…
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…
Q: Ulla Unigriffin DNA: | CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | MRNA: amino acids:
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Complementary strand for A T C and G
A: There are two types of nucleotide bases in DNA - Purines - A(Adenine) and G(Guanine) Pyrimidines -…
Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…
A: The central dogma of molecular biology is the metabolic process in which the double-helical…
Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…
A: Complementary strands are two chains of DNA that make up the double-helical structure of DNA. The…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'
A: DNA strands are boned together with the help of hydrogen bonds present between the base pairs. These…
Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE
A: Above table is codon anti-codon table for translation of DNA code into protein sequence.
Q: Joining two DNA molecules using DNA ligase. Ligation. O Adhesion. Linker Linkage.
A: DNA fragment is joined with another DNA fragment by the formation of phosphodiester bond. Enzyme…
Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…
A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…
Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of RNA making sure its…
A: DNA unlike RNA is a double-stranded molecule. In molecular biology, the genetic information in DNA…
Q: Complete the complementary stand of the DNA shown Complementary strand стАG GTAC TCAC G
A: It is the DNA strand in which the sequence if the constituent molecules on one strand matches the…
Q: Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3
A: Dna transcription is the process in which the dna makes mrna copies using the enzyme called rna…
Q: Match the correct bases pairs to find the opposite strand of DNA strand of DNA - T G C…
A: DNA is deoxyribonucleic acid. It is the genetic material which is double stranded, which means it…
Q: In a sample solution given to be analyzed; CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and…
A: DNA or deoxyribonucleotide chain is a double helical structure, containing nucleotide monomers,…
Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…
A: Click to see the answer
Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…
A: DNA molecule is a polymer of nucleotides and each nucleotide has three main components that are…
Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of DNA, making sure its…
A: According to the question, we have to give a complementary strand of DNA for the following DNA…
Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…
A: Answer: Central Dogma : It is the complete process of replication of DNA, transcription of DNA to…
Q: If a codon on DNA section is A-G-T.4 * ?fınd an anti codon on tRNA
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…
A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: One strand of a DNA molecule contains the base sequence 5'-ACTTGCCA-3'. Write its complementary base…
A: Two strands of DNA both are antiparallel and complementary to each other.
Q: . Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…
A: The central dogma of molecular biology describes the flow of genetic information in the cell from…
Q: A strand of DNA has the sequence 5'-AGTC-3'. What is the sequence of the complementary strand in the…
A: The DNA has two strands which are comprised of nucleotides- A stands for adenine, T stands for the…
Q: One strand of a DNA molecule has the base sequence CCATTG. What is the base sequence for the…
A: Chargaff’s rule of DNA base pairing: Chargaff’s rule states that number of purines and pyrimidines…
Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…
A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: G. C. C. ". 1. DNA Complement: 2. RNA strand: Complete the structure by labelling the bonds and…
A: DNA complement : It is a DNA copy of messenger RNA molecule produced by reverse transcriptase , a…
Q: polynucleotide strand has the bases G, T, C, and T, starting from the 5’ end. Assuming this is a DNA…
A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid. It is the genetic material of all…
Q: A strand of DNA has the specific sequence ATGGCTA. What would be the sequence of a complimentary…
A: Click to see the answer
Q: Transcribe the following DNA strand into a mRNA strand. TAC
A: During transcription the information in the Strand of DNA is copied into mRNA template strand.
Q: A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: A. 1. Create the complementary strand for the DNA strand below. Make sure to label the parts and…
Q: DNA G C strand DNA TAC TA C strand MRNA A UG U G codon TRNA anticod on Amino Tryptoph Stop acid an…
A: DNA replication via process of formation of DNA strand using DNA itself acting as a template. DNA…
Q: . The table opposite shows the standard (coding strand) DNA inlet codes for the 20 amino acids…
A: Given , the coding strand is 5'-CATCCAAATTGTTGCCCG-3' THE TEMPLATE STRAND WILL BE ,…
Q: Build a plypeptide DNA: TAC-TCC-CGG-GTT-ACC-ACT
A: DNA is the genetic material of the organisms like humans. The DNA is transcribed into the RNA by the…
Q: Give the full form of DNA.
A: Nucleic acid belongs to the category of the biomolecules. These nucleic acids are basically made up…