Save your program that lead to the answer in a python file (NameMatricNoQ1.py You need to insert comments on the code to explain briefly your code, by using #'. Copy the output on your code file using commented out statement or # at the end of the file. 5p + 6.5q + 7r + 3s = na? -2p + bq + 5r + 4s = 2 p+q+ 6r +5s = 9.5 12p + 5q – 7r + 3s = b %3D %3D

Q: Write a Python program that asks the user to input 2 numbers. add the 2 numbers together print a…

A: Write a code using python language that will display the output as per the following conditions:…

Q: write a python code.Take a lowercase word as an input from the user. Modify the word in such a way…

A: Python program is asked. Firstly, Take a lowercase word as an input from the user.  Modify the word…

Q: Write a program that will read a number and will display the factors of the number. Factors are…

A: Logic:-  If a number is divisible by N , it means that it is factor of that number.  So start a loop…

Q: Write a program that reads in two hexadecimal numbers prints out the sum of the two numbers in…

A: Program Without using file #include <bits/stdc++.h>using namespace std; // Map for converting…

Q: Implement the design of the Travel class in python so that the following output is produced: You…

A: Algorithm: Start Implement class Travel with a static variable count and class variables…

Q: Can you write a new code in Java language with the values ​​I sent you, just like this output?…

A: Source code:- #include <bits/stdc++.h>using namespace std; int main(){     ifstream…

Q: write a python program : Implement the design of the Chillox and Customer classes so that the…

A: ANSWER: FILENAME: Foodcart.py

Q: Write a Java program that: Ask user to enter the last two digits of the Student ID number and store…

A: Program code: import java.util.*; class Main {   public static void main(String ...args) {       //…

Q: Write a Java program that: • Ask user to enter the last two digits of the Student ID number and…

A: Actually, java is a object oriented programming language. It is a platform independent.

Q: I need help writing a simple python program - it needs to be able to read a txt file (originally an…

A: Since the html is not given, we have put methods that can help achieve the same using tags from the…

Q: Write a program in Python whose input is two integers. Output the first integer and subsequent…

A: EXPLANATION: - The user input is read by using the input function which is of type string. The…

Q: Write a program that compares the area of two rectangles. You can do this several ways, one way is…

A: The program is written in Python. Please find the program in step 2.

Q: Solve in Python: Write a program that creates a login name for a user, given the user's first name,…

A: Here I have taken input from the user and stored it into 3 different variables. Next, I have…

Q: write a python program to Create a variable containing the DNA sequence: ACGCAGAATGCTTAGGACTAGTTAC…

A: Start Declare a variable dna and initialize value Replace T with U and store it as rna Print middle…

Q: Using Python  For this assignment, we’re going to build our own song remixing solution. As an…

A: Coded using Python 3.

Q: Write program in Java: Sites like Zillow get input about house prices from a database and provide…

A: PROGRAM: //Header file import java.util.Scanner;   //Defining class public class LabProgram {…

Q: Write a Java program that will make a calculator that calculates any two numbers together,use a if…

A: import java.util.Scanner;import java.io.*; class calculator {    double addition(double n1 ,double…

Q: Write a Python program that takes a word as an input from the user and does  the following. While…

A: Coded using Python 3.

Q: In Java Only: My program is not working correctly, The history teacher at your school needs help…

A: Note: As you have asked to remove the "NullPointerException" from the calculatePoint function of the…

Q: Write a python program that keeps track of evidence from 25 forensic cases. The user should be able…

A: I have given a python code in step 2.

Q: Write a python program that reads from a text file whose name is provided by the user (see a sample…

A: Program code: #input of filenamefilename = input("Enter input filename: ") try:   # open the file in…

Q: Write a python program that lets the user play the game of Rock, Paper, Scissors against the…

A: #Rock, Paper, Scissors Game import random while True: choice=int(input("Enter your choice 1.Rock,…

Q: Write a Java program which reads a String composed of one or many words and prints out the number of…

A: Actually, Java is a programming language originally developed by James Gosling at Sun Microsystems…

Q: Write a Java program which reads a String composed of one or many words and prints out the number of…

A: import java.util.*;public class Main{ public static void main(String[] args) {     String s;     int…

Q: The image as attached is my question, I already have the answer with red text. Also I implement a…

A: import numpy as np import matplotlib.pyplot as plt import pandas as pd from sklearn import…

Q: Write a program that reads a sequence of input values and displays a bar chart of the values, using…

A: print ('******************')print ('************************************')print…

Q: Create a program which the final grade is calculated from an input like the image. So with use of…

A: According to the information given:- We have to  calculate the average grade from where the final…

Q: Write a program that prompts the user to enter an integer from 1 to 15 and displays a pyramid, as…

A: import java.util.*;import java.lang.*;import java.io.*; class Codechef{ public static void main…

Q: Write a Python program that takes a word as an input from the user and does the following. While…

A: """Program to takes a word as input and print spaces after each letter and ASCII value""" #get the…

Q: Write a python program that takes a string as an input from the user and then modifies the string in…

A: In the given code below The user must provide the input_string value. The if-else loop is used to…

Q: Modify the code to display the current date in the MM/DD/YYYYmode. And, display the number of hours,…

A: Required: Modify the code to display the current date in the MM/DD/YYYYmode. And, display the number…

Q: Write a java program called PalinPerfect that finds all palindrome perfect squares between two…

A: Code : import java.util.Scanner; public class PalinPerfect { public static void main(String[]…

Q: Write a python program which creates and outputs variables of various types.  For any lines of code…

A: Program:   #Creating variablesa=24b=9.24c="24'42'"d='42"24"'e='''34"43"'''f="""62'26'""" #output the…

Q: Write a program to extend the below program by adding an option 'g' to the menu program. If this…

A: Given: Write a program to extend the below program by adding an option 'g' to the menu program. If…

Q: Write a Java program that outputs your name, today's date, and five lines of your favorite G-rated…

A: PROGRAM: //Header file import java.io.File;  import java.io.PrintWriter;  import…

Q: Write a program in python that takes a date as input and outputs the date's season. The input is a…

A: Note: Below is the required program in python. Program Approach: Ask the user to enter month and…

Q: Write a program in python that takes a date as input and outputs the date's season. The input is a…

A: Program Approach: Ask the user to enter month and day using split() to splits a string into a list…

Q: write a python application that can verify that the email has the corect Syntax. For example, that…

A: def isValid(Email):    if Email.find(" ") != -1:        return False    if Email.find("@") == -1:…

Q: Create a python program that would perform the given description below A. The original Caesar cypher…

A: Program def encrypt(text,s): result = "" # transverse the plain text for i in range(len(text)):…

Q: Write a program that demonstrates the Dice class from the previous problem. This program will roll…

A: Below is the required code in java and sample output:

Q: Write a python that calculates the position of a car moving in a 2D-plane given the list of…

A: To write the python program with the given description: Use a while loop, that will prompt the user…

Q: In python can you make a world of Zull style adventure game. The game has to have a start and end,…

A: In python can you make a world of Zull style adventure game. The game has to have a start and end,…

Q: Please do this in Python Programming and provide Screenshots The output should be exact same like in…

A: According to the Question below the Solution:   As per our guidelines we are supposed to answer?️…

Q: Write a Python program that will ask the user to input a word, will return the first letter of the…

A: Given: Write a Python program that will ask the user to input a word, will return the first letter…

Q: Is the character repeating problem Within the Utils class that is provided to you in "Requested…

A:

Q: Write a program that reads tenintegers, and then display the number of even numbers and odd numbers.…

A: Program: import java.util.Scanner;public class Test { public static void main(String[] args) {…

Q: Write a program that makes a shape of numbers same as the one below, for a number 'x' that is…

A: the below code is in c++. The question is as follows. if the given number is 7 then 1 22 333 4444…

Q: Write a python program which takes marks of 5 subjects for 3 students using loop (for/while) and…

A: Introduction of Program: In this Python program, the User enters the 5 subjects marks of 3 different…

Q: Write a program in java which will take a set of command line parameters representing integers,…

A: Code with output is in step2.

Q: Sites like Zillow get input about house prices from a database and provide nice summaries for…

A: Given requirement, Sites like Zillow get input about house prices from a database and provide nice…