s='CTCACAGCTTGAACGGCTGTG'; a=regexp (s, '(..) AA', 'tokens', 'once'); disp (a{1}) (A) A (G) AG (M) GA (S) TG (B) C (H) AT (N) GC (T) TT (C) G (I) CA (0) GG (U) ACGT (D) T (J) CC (P) GT (V) (E) AA (K) CG (Q) TA (W) {} (F) AC (L) CT (R) TC (X) Error.

Q: 3. Implement both Prim's algorithm and Kruskal's algorithm. Compare the running times of your…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: This just colored the point  I want coloring the line also please

A: The Python program for the given problem is as follows: import matplotlib.pyplot as pltvtn = 0.7vtp…

Q: QUESTION 8 What value in base 5 is equivalent to the base 10 value of 376 (provide the number with…

A: what value of 5 is equivalent base 5 and base 10 of 376

Q: When conducting performance testing, what factors should be prioritized?

A: A computer, network, software program, or other device's speed, responsiveness, and stability may be…

Q: Write a c++ code that compare the times to traverse a list (containing a large number of elements)…

A: C++ Code

Q: What is  S variable

A: The given Python program is as follows: import seaborn as snsimport pandas as pdimport…

Q: Music Therapy Instruction: Please provide atleast 10 question about music therapy and how help…

A: The process of creating a set of instructions that tells a computer how to perform a task is known…

Q: What is the output of the following code if the user enters: 78.4 5.2 int a; double b; cin >> a >>…

A: Introduction: Programming in C++, an object-oriented language, offers applications a distinct…

Q: Create the Students and Marks tables as shown below and then perform the given SQL queries: a)…

A: SQL:- SQL stands for Structure Query Langauge. It is designed to store, retrieve and modify the data…

Q: not handwritten   1. Consider f(n) = 2n2 - 4n. Is it O(n2)? 2. Consider f(n) = 4n2 + 4n. Is it…

A: We know that, O(g(n)) = { f(n): there exist positive constants c and n0 such that 0 ≤ f(n) ≤ cg(n)…

Q: Find the solution of the following differential equations. (D³ + 8)²y=0

A: Use binomial theorem (a+b)2=a2+2ab+b2 to expand (D3+8)2 ((D3)2+16D3+64)y=0

Q: QUESTION 17 What is the dotted decimal IP address for 00001010 00000111 11010001 10111011 (use dots,…

A: INTRODUCTION: Dot-decimal notation is a means of writing integers in octet-grouped base-10 (decimal)…

Q: HTML: HTML: input:invalid {background-color: #ffcccc;} JavaScript RegEx:…

A: In the below steps i have given valid email address that can be in above options. See below steps.

Q: Atp.

A: From question The Javascript code is given below:     The 3 paragraphs are inputted for this…

Q: Express the following optimization problem as a decision problem (the closest equivalent) and a…

A: The following decision problem can be used to express the given optimization problem: Decision…

Q: 2. Write a C++ program to check whether a triangle is Equilateral, Isosceles or Scalene Example:…

A: A triangle is considered to be scalene if none of its sides are equal in length. An isosceles…

Q: Realize the following approximation of the sin(x) function.. sin x ~ 00 L i=0 (-1)⁰ (2i + 1)! -x2i+1…

A: Note : since programming language is not mentioned we are providing solution in Python Programming…

Q: When a share of common stock of some company is sold, the capital gain (or, sometimes, loss) is the…

A: from collections import deque # initialize doubled ended queue to store data of shares bought…

Q: 2. Write a function in F# that accepts the two integers as parameters, and displays the bigger…

A: To write F# function to display the bigger number and smaller number.

Q: Which of the application between two devices cannot be achieved by using Netcat? messaging file…

A: Netcat is a computer networking utility which is used for reading, writing and redirecting the…

Q: Develop a function odd_even that determines whether a number is odd or even. It must have the…

A: We need to define a function called odd_even()

Q: What will the following program output if the input sequence is 6 3 7 290 (press Enter key after…

A: Here we have a do-while loop, that will stop when the value of input will be equal to 0. In the…

Q: write a Program to reverse the d= order of the following vector elements

A: vector = c(1,1,9)print("Original vector:")print(vector)reverse = rev(vector) print("The vector in…

Q: The 7-bit ASCII value for an upper case N with an EVEN parity bit added on the end is 11011101. True…

A: Check step 2 foe the explanation

Q: Where is the solution? You just copy paste my question. Would you please check the solution?

A: In this question we have to complete the given code in C to copy the strings backward  Let's Code…

Q: is there any chance this can be in python?

A: I attached your answer below.

Q: Questiono1: UML have provided the standard to be used in diagrams, does it mean that those are the…

A: Here is the explanation regarding UML:

Q: I Need The Answer In MATLAB best wishes... With X = [14 15 19 4 12 11 27 10]; replace the odd…

A: Required: I Need The Answer In MATLABbest wishes...With X = [14 15 19 4 12 11 27 10]; replace the…

Q: The development process for a certain company involves the following products: - Problem Description…

A: Introduction:- It is defined as a process of dividing the development work of software into smaller…

Q: For the vectors a and b, and the matrix M, given by a = (61) what is the value of Mijab, using…

A: Given vectors a and b and the matrix M  a = ( 6   1) , b = ( 3    -8 )  M = 68-7-7 The formula for…

Q: # Winter 2017 Q4a def separate_and_reverse_vowels (s: str) -> list[str]: """Return a list containing…

A: Answer :

Q: Microprocessor (AVR) Fundamentals 1) - Find the contents of register R20 after each of the following…

A: As per policy three subparts can be solved once.

Q: Add PC Address Instruction Instruction memory Add Data Register # Registers Register # Register #…

A: First of all , we should make table using the given data that can be hleps us to elaborate. NAME…

Q: We want to create an extra feature for the following data with only one feature (x) to use in a…

A: I have created random data and trying to add jitter in scatter plot. def make_cubic_dataset(m,…

Q: Java - Constructors Create a class named Person that has the attributes: First name - String Last…

A: Here I have defined a class named Person. In this class, I have declared the variables and then…

Q: A Modified Accelerated Cost Recovery System (MACRS)-depre amount equal to 20% of its first cost of…

A: SummaryWhat is depreciation?Depreciation recovery is the realized gain on the sale of depreciable…

Q: Write an 8051 assembly language program that writes JOHN from the serial port to the computer screen…

A: The solution is given below for the above-given question:

Q: What is the run time efficiency (Big O value) of the segment of code shown below? for (int i = 0; i…

A: Big O is one of the ways that is used for measuring the efficiency of an algorithm. It is a notation…

Q: Consider the following set of points (1,1), (1,3), (1,8), (1,9), (5,5), (4,4), use dmin that was…

A: The solution is given below for the above given question:

Q: A frame relay frame arrives and the address field is 1101001001001011. Mark the statements below…

A: FECN is Forward Explicit Congestion Notification. This notification is used to warn the receiver of…

Q: Create the Students and Marks tables as shown below and then perform the given SQL queries: a)…

A: Required: Make the Above Tables in the Database and find the below Queries. 1. Display the Union set…

Q: Discuss the role of auditing in ensuring that the organization is actually adhering to the above…

A: The task of the auditing is to provide an expert opinion on the state of the association's finances.

Q: Select the order of nodes visited when a post-order traversal is used for the above tree.

A: In step 2, I have provided  ANSWER  WITH BRIEF EXPLANATION---------------

Q: An edge labeled with multiple symbols a, b,.... → edge labeled with the symbol. Select one: True…

A: We need to identify the above question as true or false based on statement. I have given complete…

Q: b) EMPLOYEE EMP ID 1001 1002 1003 1003 STUDENT STU FNAME STU LNAME JOHN JOHN JACK KING QUEEN KING…

A: b) Outer joins are of three types. LEFT OUTER JOIN RIGHT OUTER JOIN FULL OUTER JOIN

Q: Can the function determine if a whole number is odd? Can the function determine if a whole number is…

A: We need to rectify the errors in the given code.  * The y="non-scalar" is a strong literally, to…

Q: Question 1a: Define a function make_fasta_list_from_file that takes a single parameter, subject, the…

A: The python with the embedded self explanatory comments is given below: #file accepts a fasta file…

Q: You can implement a queue data structure (DS) using a list/array or a LinkedList DS. Nonetheless,…

A: you can implement a queue data structure using a list/array or a linkedlist ds. nonetheless, the…

Q: 9 Which of the following statements is FALSE? All randomized algorithms use pseudo random generated…

A: The process of creating a set of instructions that tells a computer how to perform a task is known…

Q: Your task is to build a simple login system to ask users for a username and a password and then ask…

A: The code above is a program written in Python that implements a simple login system. It asks users…