Some determinants of health include O Gender and Education. O Work conditions and Ecosystem Health. O Culture and Income. O All of the above.

Q: Match the description on the left side to the correct term from the choices on the right side.…

A: The living world comprises of the plants, the animals and the microorganisms which we cannot see…

Q: Describe the variety of growth forms in sac fungi

A: Introduction  Fungi are eukaryotic organisms. They can reproduce sexually as well as asexually by…

Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…

A: During DNA duplication, is the method to copy DNA stands when new cells are formed.

Q: Identify the stages of mitotic division observed in one of SimpLENI's slides labeled as A, B, and C.…

A: The stage labeled as A is Telophase. Telophase is the 4th stage of mitosis where the sister…

Q: What is the World Health Organization recommendation for the prophylaxis of rheumatic fever after a…

A: Introduction - When strep throat or scarlet fever isn't treated appropriately, rheumatic fever might…

Q: Question 52 All of the following describe the general mechanism of DNA synthesis EXCEPT: A synthesis…

A: DNA replication is the important step to protein synthesis. At the nucleoplasm of cell DNA…

Q: What is the main bloom-forming phytoplankton species in Florida Bay? Describe one factor that helps…

A: Plankton blooms means phytoplankton, microscopic plants float in the sunlight layer of the ocean.…

Q: 1. Please describe the behavior of cranes. 2. How do peregrine falcons see the world?

A: Behaviour of Cranes.. #The cranes are diurnal birds that vary in their sociality by season and…

Q: Evolutionary Sciences ask: O "Why" questions O "What" questions "How" questions O "When" questions

A: The main function of evolutionary scientists is how the today's organisms evolved into the current…

Q: Acetylcholine is necessary for the depolarization of skeletal muscle cells. Which of the following…

A: * Acetylcholine is an chemical that functions in brain and body as  neurotransmitter.  *It is an…

Q: Which option would not disturb a Hardy-Weinberg Equilibrium in a population? a) Random mating b)…

A: Hardy-Weinberg Equilibrium is the theory of population which states that the genetic variation in a…

Q: 3a. George is a marathon runner. Describe the changes in the proportion of energy supplied by…

A: Running is a method of moving very fast on foot.  While running a marathon, few things should be…

Q: The VPg protein from picornaviruses has which of the following function? O a. It packages the viral…

A: Picornaviruses are viruses that infect fishes, mammals, and birds. These group of viruses are…

Q: Stainable living strategies for people living in the Savanna Desert in Amboseli National Park…

A: Sustainable strategies are those strategies which are plant in a way to protect the environment  not…

Q: Abacteria isolated from Yellowstone National Park is found to use the chemical methane as a food…

A: Chemotrophs are organisms whose energy source is obtained by the oxidation of inorganic…

Q: 1. What causes the light pink to bright red coloraion of most adult flamingos? 2. Please describe…

A: Introduction Flamingos are a type of wading bird in the family Phoenicopteridae, they are very…

Q: Q4.6. If calcium ions, each of which has a charge of +2 (Ca2*), moved OUT OF a neuron, and no other…

A: The Charge of the ion depends on the type of charge present on the moving ion.    The Concentration…

Q: A man infected with a viral respiratory infection sneezes and releases tiny droplets containing…

A: INTRODUCTION Virus It is a microscopic infectious agent contain DNA or RNA as their genetic material…

Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…

A: * Hypo complementaemia can be referred as decreased complement levels and secondary complement…

Q: Which of the following statements about biotic potential is TRUE? Biotic potential of an organism…

A: Introduction Biotic potential:- It is the ability of a population of living species to increase…

Q: se trhe imlage to arISwer the Posterior pituitary releases oxytocin Baby suckles Oxytocin stimulates…

A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…

Q: A 3-point test cross produces the following numbers of offspring: + + a 348 How many double…

A: Test cross is a cross made between f1 (offspring)with its recessive parent to identify the dominance…

Q: Describe how a product generated from glycolysis can be used for ATP production by the electron…

A: * Glycolysis is a metabolic pathway it  converts glucose into pyruvic acid and in this process free…

Q: what to do when you have a stop codon while designing SGRNA for Crispr? I have design SGRNA but it…

A: CDS is a sequence of nucleotides that corresponds with the sequence of amino acids in a protein. A…

Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…

A: DNA is the protein in all living organisms that convey genetic information.

Q: Which of the following receptors is most implicated in the energy crisis following a concussion?…

A: A concussion is a type of brain injury that can occur after a blow to the head. Concussions can…

Q: Select the best description of permease activity in the following environmental conditions.

A:

Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? A…

A: The DNA polymerase I has two actions: - Synthesis of Okazaki fragments to complete gaps. 5/ to 3/…

Q: Question 23 All may be RNA polymerase Il promoter constituents EXCEPT: A the core element where…

A: Transcription is the process by which RNA is produced from the DNA template. This process occurs…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: Question 19 A transversion mutation would be replacing T by: (A) either A or G BU

A: Ans- In molecular genetics, transversion refers to as the point mutation in which purines are…

Q: Rice Malze Wheat Millet Sorghum 05 cereal crops provide 60% of the food energy taken in by the…

A: Cereal  Cereals are the kind of grass that are cultivated for their grains.

Q: MULTIPLE CHOICE QUESTION Which of the following is not an example of homeostasis? Chenging…

A: Homeostasis is the phenomena occuring in the living body where constant condition is maintained…

Q: which type of transmembrane protein binds to insulin and opens a transport proteins allowing glucose…

A: Insulin is an peptide hormone secreted by the beta cells of the pancreas acting through a receptor…

Q: Recent - English (en) - 23/4/2022 l a 12:00 e ial الاجابة تكون على شكل نص كتابي فقط و يمنع تحميل…

A: A BUN test is a blood test most commonly used to evaluate kidney function. It's often done along…

Q: Question 16 In base-excision repair, the first enzyme in the sequence is, _ creating a(n) _ site. (A…

A: INTRODUCTION Base excision repair This is a cellular mechanism that repairs damaged DNA.

Q: What type of tissue is this?

A: Connective tissue, epithelial tissue, muscular tissue, and nerve tissue are the four main forms of…

Q: Please could you explain how lymphocytes (especially B) can maintain receptors on their surfaces? Is…

A: Lymphocytes are a type of white blood cell that plays an important role in the immune system. They…

Q: Which of the following is not an example of homeostasis? Changing temperature Constant blood…

A: Homeostasis It is defined as the state of constant internal conditions( physical and chemical)…

Q: What slide preparation technique should you use for the following research goals? Briefly justify…

A: Microscope is an optical instrument which has major application in visualizing very small to…

Q: We are not usually consciously aware of our blood glucose levels because: O Information about blood…

A: * Nervous system divided into two main parts that is   central nervous system (CNS) peripheral…

Q: 3. Compute for the amount of each component of KCN broth if you were to prepare 280 ml. Express your…

A: We are given the amount of each component present in liter of the culture. 3 g of Polypeptone is in…

Q: true or false:  mutations add to genetic variation by producing new alleles.

A: INTRODUCTION The change in our DNA sequence that happens as a consequence of errors in DNA copying…

Q: what is the name of this structure and what fun function and pathway does if take?

A: Introduction The reactions which help in converting pyruvic acid to carbon dioxide and water in…

Q: What is the role of the sulfuric acid in the Zak- Henley's method?

A: The serum is the blood plasma without the clotting factor. After sufficient coagulation, the serum…

Q: Question 36 Most eukaryotic RNA consists of coding regions, called and noncoding regions, called A…

A: INTRODUCTION Answer to the question 36 is given below.

Q: How might diet soda lead to an individual feeling hungry?

A: Introduction A soft drink is a drink made up of water (typically carbonated), a sweetener, and…

Q: . How would you “re-create” hexaploid bread wheat fromTriticum tauschii and Emmer?

A: Durum is a form of wheat and is found to be tetraploid in nature. Bread is also a form of wheat and…

Q: HITCHHIKER'S THUMB: The distal (last) joint of the thumb can be bent back to form a 45 degree angle…

A: Hitchhiker thumb is encoded by gene present on autosomal chromosome. It is a recessive trait.

Q: a. Describe the relationship between stimulus voltage and the force of contraction b. What was the…

A: The threshold stimulus voltage is found by varying the stimulus voltage slightly to discover the…

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.