Q: Q.19. What is a lifestyle disease? List two lifestyle diseases. What is their causative?
A: Introduction In this question we will discuss about a lifestyle disease.
Q: Rain falls on a fertilized agricultural field after a farmer has harvested the crop. Which…
A: Macronutrients of plants include Carbon, Nitrogen, Phosphorous along with the role of water. In…
Q: A concussion is a mild traumatic brain injury. How might a concussion acutely affect hearing and…
A: *A concussion is traumatic brain injury which will affects brain function Caused by a blow to the…
Q: Match the following structures with their functions a. blood clotting b. matrix of blood and…
A: Human body is a complex machine required in many processes to function efficiently. To keep these…
Q: Match the different methods of analysis with the approaches in Glycomics Study of enzyme…
A: Glycomics is a subset of the field of glycobiology that aims to identify the structure and function…
Q: The two figures on the left are the plant leaf cell viewed under the high power objective (HPO).…
A:
Q: This figure can be used to represent the sequence of events leading to the evolution of dark-furred…
A: Evolution is the change in the characteristics of a species over several generations and relies on…
Q: 1. The group of Leonor and Junior conducted an experiment about the fragmentation of planaria.…
A: In this, the given paragraph includes the experimental process and the observations of…
Q: Abacteria isolated from Yellowstone National Park is found to use the chemical methane as a food…
A: Chemotrophs are organisms whose energy source is obtained by the oxidation of inorganic…
Q: Discuss the scientific approach to human sexuality from a historical perspective.
A: Human sexuality is a term that defines an integral part of the personalities and way of expressing…
Q: In 1947, Donal Hebb took some rats home from his lab at McGill University. Hebb let these rats grow…
A: Main morphological difference between neurons of rats growing in laboratory v/s rats growing in…
Q: Question 37 During bacterial RNA chain elongation, proceeds ahead of the transcription bubble…
A: The process by which RNA molecules are synthesized on a DNA template is called transcription.…
Q: Which of the following are two types of bone marrow? a) Red marrow and yellow marrow b) Red marrow…
A: Introduction- Bone marrow is the core of most bones and contains numerous blood veins. Red and…
Q: Vhat is the driving force behind divergent evolution? Explain.
A: Divergent evolution happens when a populace of animals or plants is parted into two gatherings by a…
Q: Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А B
A: *pictomicrographs shows the photograph of objects under a microscope. * objects like metal and…
Q: In terms of feeding strategies, do you think a large priapulid is more efficient than a small one?…
A: Priapulid are referred to as penis worms because of their structural morphology similar to the male…
Q: 7. RSV is a abiotic stress in plants. 8. RSV produced in the root system of plants improves the…
A: Answe :- Stage 1 Here I examine about RSV and their job in plants as indicated by fill in the clear…
Q: What is the difference between the concepts of karyotype and genome?
A: Karyotype refers to an individual's shape, size, banding patterns, and number of chromosomes. The…
Q: What is the nucleolus?
A: Introduction :- The nucleolus' primary role is to facilitate ribosome biogenesis by digesting and…
Q: Explain why the genetic code is redundant
A: Introduction :- The genetic code is made up of codons, which are three-letter nucleotide pairings…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: 1. What causes the light pink to bright red coloraion of most adult flamingos? 2. Please describe…
A: Introduction Flamingos are a type of wading bird in the family Phoenicopteridae, they are very…
Q: 7. RSV is a and as generated during times of biotic and m. abiotic stress in plants. 8. RSV produced…
A: Solution :- Stage 1 Here I examine about RSV and their job in plants as indicated by fill in the…
Q: Question 44 The term RNA refers to RNA. Blank 1 Blank 1 Add your answer
A: INTRODUCTION Answer to the question 44 is given below.
Q: Discuss the environmental consequences of biomaterials compared to non-biomaterials.
A: A biomaterial is a substance that has been developed to interact with biological systems for…
Q: Which of the stated relationships is correct? A. the heart is inferior to the clavicle B. the…
A: A large part of beginning of study of anatomy and physiology is the learning of specialised terms…
Q: 1_Vancomycin inhibits cell wall synthesis by: a.Binding irreversibly to transpeptidase and inhibit…
A: Vancomycin inhibits cell wall synthesis in gram-positive bacteria by binding firmly to the…
Q: Referring to Figure 17-26, draw the product if breaks occurred within genes A and B
A: An inversion is a chromosomal rearrangement where a portion of a chromosome is flipped end-to-end.…
Q: What are the checkpoints in the completion of the life cycle of nematomorphs? Would it be easier if…
A: The phylum Nematomorpha (also called horsehair worms) is constituted of orders: Nectonematoidea…
Q: What similarities and what differences between the graphs? What antibiotics were the most…
A: These graphs are based on the observation of bacteria collected from cave and were tested for…
Q: What aminos acid would the anticodon GAC be translated into?
A: * DNA will have four nucleotides Adenine Guanine Cytosine Thymine * RNA will have four…
Q: Which choice besi describes the location of the majority of the musculo-skeletal system? A. It is in…
A: Introduction Musculoskeletal system:- It is made up of the body's bones (the skeleton), joints,…
Q: quality assurance
A:
Q: explain also.
A: PABP (Poly A binding protein) is a RNA binding protein which triggers the binding of eukaryotic…
Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…
A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…
Q: How might diet soda lead to an individual feeling hungry?
A: Introduction A soft drink is a drink made up of water (typically carbonated), a sweetener, and…
Q: Identify the stages of mitotic division observed in one of SimpLENI's slides labeled as A, B, and C.…
A: The stage labeled as A is Telophase. Telophase is the 4th stage of mitosis where the sister…
Q: Question 23 Which of the following is an underlying requirement for universal health coverage? High…
A: Which of the following is an underlying requirement for universal health coverage? A. High quality…
Q: 1. Infections caused may fall into one of four categories which vary depending on the site affected…
A: Infections It is defined as the invasion of organism's body cells by disease causing pathogens.…
Q: 12. Below is a diagram of a cell. Which of the following is true? a. The cell is a plant cell,…
A:
Q: Match the following Prompts An AT-rich region found in eukaryotic promoters is called the box. The…
A: 1. An AT rich region found in the eukaryotic promoters is called the "TATA box". The consensus…
Q: Synthetic opioids are frequently being used for analgesia, i.e. as pain killers. While morphine or…
A: * Synthetic opioids used for analgesia as pain killers. *morphine and other agonists like fentanyl…
Q: Question 14 Which of the following is NOT true regarding E. coli replication on the lagging strand?…
A: In case of E. Coli replication of lagging strand: The synthesis is discontinuous and occurs 5' to 3'…
Q: which germ layer (tissue) gives rice to our nervous system and outer coverings. a) endotherm b)…
A: The mesoderm, or middle tissue, gives rise to most of the muscle and connective tissues. Finally the…
Q: A gobi fish creates a burrow at the bottom of the ocean floor. A species of shrimp soon moves into…
A: This relationship, between Gobi fish and shrimp, is called mutualism, where both the individual are…
Q: 2. Assume 250 base pairs to be responsible for a particular portion of mRNA molecule. What is the…
A: bp = base pair—one bp corresponds to approximately 3.4 Å of length along the strand 1angstrom (Å),…
Q: Which of the stated relationships is correct? A. the heart is inferior to the clavicle B. the…
A: Introduction Proximal means close to or near the trunk or the origin of a part (example, the…
Q: true or false:  mutations add to genetic variation by producing new alleles.
A: INTRODUCTION The change in our DNA sequence that happens as a consequence of errors in DNA copying…
Q: A 3-point test cross produces the following numbers of offspring: The yellow cells are the…
A: The three point test cross data is given in the question. The three genes are involved in a three…
Q: What is pecten and what is thought to be its function? 2. Please describe the typical hunting…
A: Note- As per Bartleby rules, we are supposed to answer only first three questions. Kindly repost The…
1. Please describe the behavior of cranes.
2. How do peregrine falcons see the world?
3. What is special about the saliva of openbills?
4. Why have Leptophiles lost their feathers?
Step by step
Solved in 2 steps
- 1. What is special about the saliva of openbills? 2. Why have members of Leptoptilos los their feathers? 3. What causes the light pink to bright red coloration of most adult flamingos? 4. Please describe the feeding apparatus of Flamingos.1. give a taxonomic account of venomous reptiles in ghana. 2.A student picked up a lizard with her bare hand for a minute, and let go of the lizard. while handling the lizard she noticed the lizard head butting her hand. she suffered swelling of that arm up to the shoulder with pain. following shortly by numbness in that arm and nausea. was the lizard a venomous or a poisonous one?1. Why do megapodiidae have an incubating egg and what does it do? 2. How does being non-migratory affect galliforms' anatomy and physiology? 3. What is crop milk and when is it produced? 4. What are apteria? Do penguins possess them?
- Think about thrush. This is an example of what type of parasite? A. thallus, fungus B. yeast, single celled fungus C. mold, multicellular fungus D. nematode1. What is a casque? Which members of Casuariiformes have one, and what is though to be its function? 2. Please describe how cassowaries have weaponized their feet.1. What is the function of the gill rakers?2. Explain how gas exchange occurs at the gills.3. What is the function of the lateral line?4. Describe how the scales are arranged on the trunk & tail of a tilapia.5. Explain how the swim bladder controls buoyancy.
- In Dictyostelium, cheats must modify their behavior when in a chimera to take advantage of their partner. A. depends on whether they perform direct reciprocity B. FALSE C. depends on whether they perform indirect reciprocity D. TRUEThe rhynchocoel is a ________. a. circulatory system b. fluid-filled cavity c. primitive excretory system d. proboscis1. Conduct research on the Annelid-Worm. Use at least 100 words.
- To acquire nutrients, spongesa. filter microorganisms from water brought in throughpores.b. use stinging cells to capture small prey.c. parasitize larger animals.d. suck nutrients from prey after injecting enzymes thatdissolve prey tissues.Poison glands of snakes are homologous to: A. electric organs of fishes B. stings of rays C. sebaceous glands of mammals D. salivary glands of vertebratesTell about the tail of Lizard?
